ID: 1060009150

View in Genome Browser
Species Human (GRCh38)
Location 9:120028136-120028158
Sequence CAAAGGAAAATGCATACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060009147_1060009150 24 Left 1060009147 9:120028089-120028111 CCAGGAACATACTTGTAGTCAAA No data
Right 1060009150 9:120028136-120028158 CAAAGGAAAATGCATACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060009150 Original CRISPR CAAAGGAAAATGCATACCAT GGG Intergenic
No off target data available for this crispr