ID: 1060010045

View in Genome Browser
Species Human (GRCh38)
Location 9:120035956-120035978
Sequence CCACTGTGCCAGGCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060010045_1060010051 5 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010051 9:120035984-120036006 GCCTGTAATCCCAGCAGTTTGGG 0: 2757
1: 231714
2: 280934
3: 229260
4: 268565
1060010045_1060010055 14 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010055 9:120035993-120036015 CCCAGCAGTTTGGGAGGTCAAGG 0: 44
1: 4172
2: 95938
3: 219025
4: 239125
1060010045_1060010059 21 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010059 9:120036000-120036022 GTTTGGGAGGTCAAGGTGGGCGG 0: 20
1: 1276
2: 27507
3: 82926
4: 165557
1060010045_1060010057 17 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010057 9:120035996-120036018 AGCAGTTTGGGAGGTCAAGGTGG 0: 42
1: 2803
2: 66806
3: 156870
4: 161824
1060010045_1060010058 18 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010058 9:120035997-120036019 GCAGTTTGGGAGGTCAAGGTGGG 0: 23
1: 1659
2: 38345
3: 146594
4: 244700
1060010045_1060010050 4 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010050 9:120035983-120036005 TGCCTGTAATCCCAGCAGTTTGG 0: 1368
1: 98913
2: 242362
3: 303850
4: 258834
1060010045_1060010060 22 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010060 9:120036001-120036023 TTTGGGAGGTCAAGGTGGGCGGG 0: 11
1: 394
2: 1670
3: 3872
4: 5780
1060010045_1060010053 8 Left 1060010045 9:120035956-120035978 CCCTGGCCTGCCTGGCACAGTGG No data
Right 1060010053 9:120035987-120036009 TGTAATCCCAGCAGTTTGGGAGG 0: 3819
1: 309289
2: 271603
3: 206826
4: 226724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060010045 Original CRISPR CCACTGTGCCAGGCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr