ID: 1060021900

View in Genome Browser
Species Human (GRCh38)
Location 9:120138927-120138949
Sequence ATGAGCAAGACCAAAACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060021899_1060021900 -9 Left 1060021899 9:120138913-120138935 CCAACGCAAGTCACATGAGCAAG No data
Right 1060021900 9:120138927-120138949 ATGAGCAAGACCAAAACTACTGG No data
1060021898_1060021900 6 Left 1060021898 9:120138898-120138920 CCAGCATTTCATTGGCCAACGCA No data
Right 1060021900 9:120138927-120138949 ATGAGCAAGACCAAAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060021900 Original CRISPR ATGAGCAAGACCAAAACTAC TGG Intergenic
No off target data available for this crispr