ID: 1060022738

View in Genome Browser
Species Human (GRCh38)
Location 9:120146350-120146372
Sequence TTTCTGTTCTCACCTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060022736_1060022738 6 Left 1060022736 9:120146321-120146343 CCTCATTGCAGCTGTAGTTGAAA No data
Right 1060022738 9:120146350-120146372 TTTCTGTTCTCACCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060022738 Original CRISPR TTTCTGTTCTCACCTGACCC AGG Intergenic
No off target data available for this crispr