ID: 1060025772

View in Genome Browser
Species Human (GRCh38)
Location 9:120169889-120169911
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060025772_1060025777 21 Left 1060025772 9:120169889-120169911 CCAGCACTTCATTAACACTCTCT No data
Right 1060025777 9:120169933-120169955 CATTCCCCATTTAACATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060025772 Original CRISPR AGAGAGTGTTAATGAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr