ID: 1060025777

View in Genome Browser
Species Human (GRCh38)
Location 9:120169933-120169955
Sequence CATTCCCCATTTAACATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060025773_1060025777 -10 Left 1060025773 9:120169920-120169942 CCGCCCAAAACCACATTCCCCAT No data
Right 1060025777 9:120169933-120169955 CATTCCCCATTTAACATATAAGG No data
1060025772_1060025777 21 Left 1060025772 9:120169889-120169911 CCAGCACTTCATTAACACTCTCT No data
Right 1060025777 9:120169933-120169955 CATTCCCCATTTAACATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060025777 Original CRISPR CATTCCCCATTTAACATATA AGG Intergenic
No off target data available for this crispr