ID: 1060026233

View in Genome Browser
Species Human (GRCh38)
Location 9:120174358-120174380
Sequence CAGACTCAGCACCGGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060026226_1060026233 22 Left 1060026226 9:120174313-120174335 CCATCCTGATAATGAAGCTCACT No data
Right 1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG No data
1060026227_1060026233 18 Left 1060026227 9:120174317-120174339 CCTGATAATGAAGCTCACTAAGC No data
Right 1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG No data
1060026230_1060026233 -10 Left 1060026230 9:120174345-120174367 CCTTGGAGTCAGACAGACTCAGC No data
Right 1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060026233 Original CRISPR CAGACTCAGCACCGGGACCT TGG Intergenic
No off target data available for this crispr