ID: 1060027390

View in Genome Browser
Species Human (GRCh38)
Location 9:120184762-120184784
Sequence CACCTTGGACAACTTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060027390_1060027394 10 Left 1060027390 9:120184762-120184784 CCAAAGGCAAGTTGTCCAAGGTG No data
Right 1060027394 9:120184795-120184817 TGCCCCAACCCCCTAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060027390 Original CRISPR CACCTTGGACAACTTGCCTT TGG (reversed) Intergenic
No off target data available for this crispr