ID: 1060027814

View in Genome Browser
Species Human (GRCh38)
Location 9:120187708-120187730
Sequence TTTCTTTTCTCAAGAAACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060027814_1060027815 13 Left 1060027814 9:120187708-120187730 CCGGGGTTTCTTGAGAAAAGAAA No data
Right 1060027815 9:120187744-120187766 AAGATGATCAGTGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060027814 Original CRISPR TTTCTTTTCTCAAGAAACCC CGG (reversed) Intergenic
No off target data available for this crispr