ID: 1060030069

View in Genome Browser
Species Human (GRCh38)
Location 9:120206893-120206915
Sequence CTCTTTGTACAGATTTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060030069_1060030072 6 Left 1060030069 9:120206893-120206915 CCCACCTAAATCTGTACAAAGAG No data
Right 1060030072 9:120206922-120206944 GCAACTGCACACCATACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060030069 Original CRISPR CTCTTTGTACAGATTTAGGT GGG (reversed) Intergenic
No off target data available for this crispr