ID: 1060035275

View in Genome Browser
Species Human (GRCh38)
Location 9:120250205-120250227
Sequence GAGGGTACGTAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060035275_1060035280 -4 Left 1060035275 9:120250205-120250227 CCATCCTCCTTCTACGTACCCTC No data
Right 1060035280 9:120250224-120250246 CCTCCTCTAGTACTGCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060035275 Original CRISPR GAGGGTACGTAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr