ID: 1060038931

View in Genome Browser
Species Human (GRCh38)
Location 9:120283168-120283190
Sequence TGGGACTCATTGGAAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060038931_1060038939 19 Left 1060038931 9:120283168-120283190 CCAAATTTTTCCAATGAGTCCCA No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038931_1060038933 -5 Left 1060038931 9:120283168-120283190 CCAAATTTTTCCAATGAGTCCCA No data
Right 1060038933 9:120283186-120283208 TCCCAATCCCCACATTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060038931 Original CRISPR TGGGACTCATTGGAAAAATT TGG (reversed) Intergenic
No off target data available for this crispr