ID: 1060038933

View in Genome Browser
Species Human (GRCh38)
Location 9:120283186-120283208
Sequence TCCCAATCCCCACATTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060038931_1060038933 -5 Left 1060038931 9:120283168-120283190 CCAAATTTTTCCAATGAGTCCCA No data
Right 1060038933 9:120283186-120283208 TCCCAATCCCCACATTTAAGAGG No data
1060038930_1060038933 18 Left 1060038930 9:120283145-120283167 CCATTCAGAAATGCACATACAAT No data
Right 1060038933 9:120283186-120283208 TCCCAATCCCCACATTTAAGAGG No data
1060038929_1060038933 26 Left 1060038929 9:120283137-120283159 CCAGTGATCCATTCAGAAATGCA No data
Right 1060038933 9:120283186-120283208 TCCCAATCCCCACATTTAAGAGG No data
1060038928_1060038933 27 Left 1060038928 9:120283136-120283158 CCCAGTGATCCATTCAGAAATGC No data
Right 1060038933 9:120283186-120283208 TCCCAATCCCCACATTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060038933 Original CRISPR TCCCAATCCCCACATTTAAG AGG Intergenic
No off target data available for this crispr