ID: 1060038939

View in Genome Browser
Species Human (GRCh38)
Location 9:120283210-120283232
Sequence GAATCTCTCTTTCCACTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060038938_1060038939 -8 Left 1060038938 9:120283195-120283217 CCACATTTAAGAGGAGAATCTCT No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038932_1060038939 9 Left 1060038932 9:120283178-120283200 CCAATGAGTCCCAATCCCCACAT No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038937_1060038939 -7 Left 1060038937 9:120283194-120283216 CCCACATTTAAGAGGAGAATCTC No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038931_1060038939 19 Left 1060038931 9:120283168-120283190 CCAAATTTTTCCAATGAGTCCCA No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038936_1060038939 -6 Left 1060038936 9:120283193-120283215 CCCCACATTTAAGAGGAGAATCT No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038935_1060038939 -1 Left 1060038935 9:120283188-120283210 CCAATCCCCACATTTAAGAGGAG No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data
1060038934_1060038939 0 Left 1060038934 9:120283187-120283209 CCCAATCCCCACATTTAAGAGGA No data
Right 1060038939 9:120283210-120283232 GAATCTCTCTTTCCACTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060038939 Original CRISPR GAATCTCTCTTTCCACTACC TGG Intergenic
No off target data available for this crispr