ID: 1060042097

View in Genome Browser
Species Human (GRCh38)
Location 9:120308638-120308660
Sequence CTGTGCCTCTTGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060042088_1060042097 7 Left 1060042088 9:120308608-120308630 CCACAGCCTGGACTGGCTGGGTG No data
Right 1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG No data
1060042087_1060042097 8 Left 1060042087 9:120308607-120308629 CCCACAGCCTGGACTGGCTGGGT No data
Right 1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG No data
1060042082_1060042097 30 Left 1060042082 9:120308585-120308607 CCACTGGAGCATGGATATGATGC No data
Right 1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG No data
1060042091_1060042097 1 Left 1060042091 9:120308614-120308636 CCTGGACTGGCTGGGTGGGCAGG No data
Right 1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060042097 Original CRISPR CTGTGCCTCTTGAGGGAGGA AGG Intergenic
No off target data available for this crispr