ID: 1060045048

View in Genome Browser
Species Human (GRCh38)
Location 9:120333214-120333236
Sequence CCTAACCTGCAGCAGCAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060045036_1060045048 15 Left 1060045036 9:120333176-120333198 CCATTCAGCCTCTCTGAATCATG No data
Right 1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG No data
1060045039_1060045048 7 Left 1060045039 9:120333184-120333206 CCTCTCTGAATCATGGAGAGGTG No data
Right 1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060045048 Original CRISPR CCTAACCTGCAGCAGCAGGG GGG Intergenic
No off target data available for this crispr