ID: 1060045048 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:120333214-120333236 |
Sequence | CCTAACCTGCAGCAGCAGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060045036_1060045048 | 15 | Left | 1060045036 | 9:120333176-120333198 | CCATTCAGCCTCTCTGAATCATG | No data | ||
Right | 1060045048 | 9:120333214-120333236 | CCTAACCTGCAGCAGCAGGGGGG | No data | ||||
1060045039_1060045048 | 7 | Left | 1060045039 | 9:120333184-120333206 | CCTCTCTGAATCATGGAGAGGTG | No data | ||
Right | 1060045048 | 9:120333214-120333236 | CCTAACCTGCAGCAGCAGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060045048 | Original CRISPR | CCTAACCTGCAGCAGCAGGG GGG | Intergenic | ||
No off target data available for this crispr |