ID: 1060051880

View in Genome Browser
Species Human (GRCh38)
Location 9:120383712-120383734
Sequence TCGGGGGCCCGCGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060051865_1060051880 18 Left 1060051865 9:120383671-120383693 CCTGTGTGCTGGCCTGTCTCCCA No data
Right 1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG No data
1060051870_1060051880 -2 Left 1060051870 9:120383691-120383713 CCATGCTTGACTGGGAGTGCCTC No data
Right 1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG No data
1060051867_1060051880 6 Left 1060051867 9:120383683-120383705 CCTGTCTCCCATGCTTGACTGGG No data
Right 1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG No data
1060051864_1060051880 28 Left 1060051864 9:120383661-120383683 CCACGGATCACCTGTGTGCTGGC No data
Right 1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG No data
1060051869_1060051880 -1 Left 1060051869 9:120383690-120383712 CCCATGCTTGACTGGGAGTGCCT No data
Right 1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060051880 Original CRISPR TCGGGGGCCCGCGGGGCTCT GGG Intergenic
No off target data available for this crispr