ID: 1060052508

View in Genome Browser
Species Human (GRCh38)
Location 9:120387294-120387316
Sequence TCCCAGGTAGAGGTCCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060052501_1060052508 2 Left 1060052501 9:120387269-120387291 CCTGAGTTTTGGGTTAAAAAAAG No data
Right 1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG No data
1060052500_1060052508 3 Left 1060052500 9:120387268-120387290 CCCTGAGTTTTGGGTTAAAAAAA No data
Right 1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060052508 Original CRISPR TCCCAGGTAGAGGTCCTTGG GGG Intergenic
No off target data available for this crispr