ID: 1060053153

View in Genome Browser
Species Human (GRCh38)
Location 9:120391350-120391372
Sequence TCCTTTGTCGCTGTGTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060053153_1060053163 29 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data
1060053153_1060053154 -2 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053154 9:120391371-120391393 GACTCGTCCCAAATCTAGACTGG No data
1060053153_1060053157 15 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053157 9:120391388-120391410 GACTGGCCCCAGCACAGAGCTGG No data
1060053153_1060053158 16 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053158 9:120391389-120391411 ACTGGCCCCAGCACAGAGCTGGG No data
1060053153_1060053162 28 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053162 9:120391401-120391423 ACAGAGCTGGGACTCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060053153 Original CRISPR TCCTTTGTCGCTGTGTTCCT CGG (reversed) Intronic
900018822 1:172509-172531 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
900049080 1:531104-531126 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
900071310 1:772928-772950 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
902561820 1:17282379-17282401 TCCTTTGCTTCTCTGTTCCTGGG + Intronic
905110229 1:35589409-35589431 TCCTGTGTCTCTGTGTCCCTGGG + Intronic
905962428 1:42054992-42055014 CCCTTTTTAGCTGTATTCCTAGG + Intergenic
906381510 1:45334978-45335000 TCTTTTGTCCCTCTGATCCTTGG - Intronic
907272318 1:53298267-53298289 GCCTTTGTCGGTCTGTCCCTCGG - Intronic
907778845 1:57545422-57545444 TGATTTGTCGCAGTTTTCCTAGG + Intronic
910417123 1:87013013-87013035 TCCCTTGTGACTGTGTTCATGGG + Intronic
914901595 1:151714066-151714088 TGCTCTGTGGCTCTGTTCCTGGG + Intronic
915398411 1:155603973-155603995 TCTTTTCTCTCTGTCTTCCTGGG - Intergenic
915995797 1:160561936-160561958 TCCTTGTTAGCTGTATTCCTAGG - Intronic
915995801 1:160562000-160562022 TCCTTGTTAGCTGTATTCCTAGG - Intronic
916360708 1:163963809-163963831 TTCTTTGTACCTGTGTTTCTTGG - Intergenic
916872296 1:168928995-168929017 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
917295286 1:173512370-173512392 CCCTTGTTAGCTGTGTTCCTAGG + Intronic
917640962 1:176982811-176982833 TCTTTTCACTCTGTGTTCCTGGG - Intronic
918004464 1:180528600-180528622 TCCTCTGTCTCTGAGTTCCAGGG + Intergenic
919738557 1:200968967-200968989 TCCTTACTAGCTGTGATCCTGGG + Intergenic
921256534 1:213345788-213345810 TCCTTTGACACTCTGCTCCTTGG + Intergenic
922106673 1:222518377-222518399 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
924247986 1:242103612-242103634 TCCTGTGTCTCTGACTTCCTAGG + Intronic
924348855 1:243095943-243095965 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
924652677 1:245944415-245944437 TCCTTGTTAGCTGTATTCCTAGG - Intronic
1063154195 10:3363320-3363342 TGCTGTGACGCTGTGTCCCTGGG - Intergenic
1063925687 10:10975095-10975117 TCCTTTGTGGCTATGTGACTTGG + Intergenic
1065841730 10:29707357-29707379 TCCTTGTTAGCTGTATTCCTAGG + Intronic
1066727510 10:38408960-38408982 TCTTTTGTCACTGTGTTCAGAGG - Intergenic
1067723548 10:48748961-48748983 GCCTTGGTGGCTGTGTTCTTTGG + Intronic
1068099825 10:52538342-52538364 TCTCTTTTAGCTGTGTTCCTAGG + Intergenic
1068493178 10:57749958-57749980 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1070553008 10:77505691-77505713 TCATTCCTCCCTGTGTTCCTGGG - Intronic
1071163022 10:82773406-82773428 TCCTTTGTCCCTTTTTTCCTTGG + Intronic
1071229181 10:83564993-83565015 TCCTTGCTTGCTGTGTTCCGCGG - Intergenic
1071333746 10:84585344-84585366 GCCTTTGGCTCTGTGCTCCTTGG - Intergenic
1073466397 10:103696843-103696865 TCCCATGTCCCTGTTTTCCTGGG - Intronic
1075545386 10:123351155-123351177 TCCTCTGTCGCTGTGACCCGAGG - Intergenic
1075582515 10:123632985-123633007 CCCTTTTTAGCTGTATTCCTCGG - Intergenic
1075899441 10:126028107-126028129 TCCCTTGTAGCTGCATTCCTAGG - Intronic
1076975424 11:167705-167727 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
1078502043 11:11889481-11889503 TCCTTGTTAGCTGTATTCCTGGG - Intronic
1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG + Intergenic
1080215377 11:29833753-29833775 CCCTTGGTAGCTGTATTCCTAGG - Intergenic
1080705295 11:34686336-34686358 TCCATTGCAGCTGTTTTCCTGGG - Intergenic
1081402080 11:42655154-42655176 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1083527702 11:63385511-63385533 TCCTTGTTAGCTGTATTCCTAGG + Intronic
1083902786 11:65651748-65651770 TTCTTTGACGCTGGGTTCCTGGG - Intergenic
1085677266 11:78534908-78534930 TCTTTTATTGCTGTATTCCTTGG - Intronic
1086487076 11:87317526-87317548 TCCTTTGTTGCTTTGCTCTTTGG + Intronic
1088718707 11:112573149-112573171 TCCTTTGTGGCTGGGGTCATGGG + Intergenic
1091252326 11:134154305-134154327 ACCTCAATCGCTGTGTTCCTAGG + Intronic
1092025204 12:5233893-5233915 TCCTTTAACTCTGTTTTCCTGGG - Intergenic
1093085093 12:14858093-14858115 CCCTTTTTCACTGTATTCCTAGG + Intronic
1093495259 12:19749434-19749456 TCCTTTTTAGCCGTGTTCCTAGG + Intergenic
1095925695 12:47576625-47576647 TCCTTTATTCCTGTGTTGCTCGG - Intergenic
1096557974 12:52415443-52415465 TCCTTTGTTCGTGTTTTCCTCGG + Intergenic
1097422248 12:59394464-59394486 TCCTTGGTAGCTGTATTCCTAGG - Intergenic
1099527346 12:83731750-83731772 TCCTTTGTAGTTGTATTCCTAGG + Intergenic
1099549502 12:84025305-84025327 CCCTTTTTAGCTGTATTCCTAGG - Intergenic
1099683919 12:85861924-85861946 ACCTTTTTAGCTGTGTTCGTAGG + Intergenic
1100823748 12:98455776-98455798 GCTTTTGTTGCTGTCTTCCTGGG - Intergenic
1101427142 12:104597611-104597633 TCATTTGTTGCTGTGGTGCTTGG - Intronic
1106214839 13:27687056-27687078 TTCTTTTTCTCTGTGTTCTTTGG - Intergenic
1106290438 13:28356270-28356292 TCCTTGCTCTCTGTGTTCCCTGG + Intronic
1106571630 13:30933077-30933099 GCCTTTGGCCCTGTTTTCCTTGG - Intronic
1107130104 13:36886146-36886168 TACTTAATCTCTGTGTTCCTTGG - Intronic
1107512415 13:41097873-41097895 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1108030493 13:46224158-46224180 TCCTTTGTCTCTTTGCCCCTGGG + Intronic
1108113886 13:47107039-47107061 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1109067181 13:57711517-57711539 TGCTTTTTAGCTGTATTCCTTGG + Intronic
1109102030 13:58197856-58197878 TCATTTGTCCCAGTGTTCCTTGG - Intergenic
1110525739 13:76534576-76534598 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1111622080 13:90737183-90737205 TCCCTTGTAACTGTGTTCCTAGG - Intergenic
1112055538 13:95687088-95687110 TCCTTGGTCAGTGTTTTCCTAGG + Intronic
1115764606 14:36610449-36610471 TCCTTGTTAGCTGTCTTCCTAGG - Intergenic
1116022436 14:39477724-39477746 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1118676931 14:68196214-68196236 TCCTTTGTCGCTTTCTTGCTGGG + Intronic
1119072917 14:71606132-71606154 TGCTCTGTGGCTGTGCTCCTGGG + Intronic
1120321385 14:82966005-82966027 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1120588129 14:86341414-86341436 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1120633528 14:86922391-86922413 TCCTCTGTCTCTATGTTTCTTGG + Exonic
1122370890 14:101228449-101228471 TACTTTGTCACCTTGTTCCTCGG - Intergenic
1122859868 14:104577714-104577736 GCCTTAGTTGCTGTGTTCCCGGG + Intronic
1125119686 15:36139745-36139767 TCCTTGTTAGCTGTATTCCTGGG + Intergenic
1125366995 15:38928172-38928194 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1125373665 15:39005130-39005152 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
1126554483 15:49970545-49970567 TCCTTGTTCGCTGTATTTCTAGG - Intronic
1126979412 15:54225526-54225548 TCCTTGTTAGCTGTATTCCTGGG + Intronic
1127167296 15:56258505-56258527 TCCTTGTTAGCTGTATTCCTAGG + Intronic
1128419460 15:67477945-67477967 TCCTTTGTCTCTGAGTTGATCGG + Intronic
1129356732 15:74996489-74996511 CCCTTTCTCTCTGTGTCCCTGGG - Intronic
1133551893 16:6864208-6864230 TTCTATGTCACTGTATTCCTAGG + Intronic
1134358948 16:13512281-13512303 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
1134671816 16:16061358-16061380 TCCTTTGTCCCTGTGTTGTAGGG + Intronic
1135155123 16:20046199-20046221 TCCTTTGTCCTTGTCTTCATAGG - Intronic
1135260685 16:20977923-20977945 GCCTCTGTTGCTCTGTTCCTGGG - Intronic
1135466714 16:22692927-22692949 TTCTTTGTCACTGGGATCCTTGG + Intergenic
1135858732 16:26035786-26035808 GCCATTGACTCTGTGTTCCTGGG + Intronic
1135960703 16:26992557-26992579 TCCTTAGTTGCTTTGTGCCTTGG - Intergenic
1138922844 16:61554268-61554290 TCCTTTGCCTCTGTCCTCCTGGG - Intergenic
1139617634 16:68108793-68108815 CCCTTGTTAGCTGTGTTCCTAGG + Intronic
1139692898 16:68652348-68652370 TCATATGCCACTGTGTTCCTAGG + Intronic
1140125364 16:72113535-72113557 CCCTTTCTCCCTCTGTTCCTGGG + Intronic
1140894529 16:79313569-79313591 TCCCCTGTCTCTGTCTTCCTTGG + Intergenic
1140971981 16:80022313-80022335 TCCTTTTCCTCTGTCTTCCTTGG + Intergenic
1142444836 16:90129954-90129976 TCTTTTGTCACTGTGTTCAGAGG - Intergenic
1142462675 17:105512-105534 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
1143756899 17:9073887-9073909 CTCTTTGTGGCTGTTTTCCTGGG + Intronic
1146708606 17:35021001-35021023 TCCTTTGTTGCAGTCTTCATTGG - Intronic
1149246857 17:54719340-54719362 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1149377496 17:56060148-56060170 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1149804889 17:59607135-59607157 TCGTGTGTCACTGTGGTCCTGGG - Exonic
1155391378 18:25340774-25340796 ATCTTTGTCCCTGTGTCCCTAGG - Intronic
1155432581 18:25776174-25776196 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
1156288916 18:35727797-35727819 TCCTTAGTTACTGTATTCCTAGG - Intergenic
1156861005 18:41836256-41836278 TCCTTTGCCTTTGTCTTCCTGGG + Intergenic
1156965197 18:43083153-43083175 TCCCTTGTAGTTGTATTCCTAGG - Intronic
1157287771 18:46388876-46388898 TTCTTTATCTCTGTGTTCTTAGG - Intronic
1158994570 18:62904736-62904758 TCCCCTGTCACTGTGTTTCTTGG - Intronic
1160365176 18:78318649-78318671 TCTTTTCTCGCTGTGATCCCAGG - Intergenic
1160652380 19:237888-237910 TCTTTTGTCACTGTGTTCAGAGG + Intergenic
1161275462 19:3414017-3414039 TCTGTTGCCGCTGTGTCCCTTGG + Intronic
1164264858 19:23605651-23605673 TCCTTGTTAGCTGTATTCCTAGG + Intronic
1165095505 19:33407734-33407756 TCTTTTCCCGCTGTGATCCTGGG - Intronic
1165136855 19:33674992-33675014 TCCTGTGTATCTGTGTGCCTGGG - Intronic
1166241210 19:41495629-41495651 TCCTCTGTGGTTATGTTCCTAGG - Intergenic
1167807737 19:51800193-51800215 TCCTTGGTTGCTGCATTCCTTGG + Intronic
1168229771 19:55022782-55022804 TCCTTGTTAGCTGTATTCCTAGG - Intronic
925720330 2:6820978-6821000 TCCATGGTCCCTCTGTTCCTGGG - Intergenic
928900440 2:36312223-36312245 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
929964493 2:46523949-46523971 CCCTTGTTAGCTGTGTTCCTAGG + Intronic
930798048 2:55413612-55413634 TCTTTTGTCTCTGTATTCTTAGG - Intronic
932111094 2:69001343-69001365 TCCTTGCTAGCTGTATTCCTAGG + Intergenic
932941606 2:76173250-76173272 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
933052436 2:77616372-77616394 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
933237319 2:79879536-79879558 TCCTTGTTAGCTGTATTCCTAGG + Intronic
933401798 2:81807949-81807971 TCCTATGAAGCTGTATTCCTTGG - Intergenic
933703674 2:85274044-85274066 TCCCCTGTCGCTGTGTGCCTGGG - Intronic
933846620 2:86332050-86332072 TCCTTTTTCCCTGTATTCCCAGG + Intronic
934107103 2:88704992-88705014 TCCTTGTTAGCTGTATTCCTAGG - Intronic
935923219 2:108037593-108037615 CCCTTTTTAGCTGTATTCCTAGG + Intergenic
936228707 2:110680763-110680785 GCCTTTGTTGCTGTCTTCCAGGG + Intergenic
937282468 2:120729589-120729611 TGCTTTGTGTCTGTGTTACTTGG - Intergenic
937397604 2:121551622-121551644 TCCTGGTTCGCTGTATTCCTAGG - Intronic
940610975 2:155991457-155991479 CCCTCTGTAGCTGTATTCCTAGG + Intergenic
940745525 2:157563391-157563413 TCCTTGTTAGCTGTATTCCTAGG - Intronic
943898998 2:193407852-193407874 TCCTTATTAGCTGTATTCCTAGG - Intergenic
944378795 2:199081733-199081755 TCCTTTTAAGCTGTGTTCCAAGG + Intergenic
944411408 2:199446911-199446933 TCATCTGTCGCTGAGTTTCTTGG - Intronic
946240639 2:218352848-218352870 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
946523567 2:220493462-220493484 TCCATTTCCGCTGTGTTCCAAGG + Intergenic
1174045044 20:47727386-47727408 TCCTTTGCCCTTGAGTTCCTGGG - Intronic
1175591609 20:60197132-60197154 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1176332638 21:5562737-5562759 TCCTTCTTAGCTGTATTCCTTGG + Intergenic
1176395119 21:6258214-6258236 TCCTTCTTAGCTGTATTCCTTGG - Intergenic
1176442038 21:6730890-6730912 TCCTTCTTAGCTGTATTCCTTGG + Intergenic
1176466300 21:7057959-7057981 TCCTTCTTAGCTGTATTCCTTGG + Intronic
1176489861 21:7439737-7439759 TCCTTCTTAGCTGTATTCCTTGG + Intergenic
1176666588 21:9693287-9693309 TTCTTTGTCACTGTGTGGCTGGG + Intergenic
1177618971 21:23562039-23562061 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1177878529 21:26665277-26665299 CCCTTGTTGGCTGTGTTCCTAGG + Intergenic
1179930027 21:44562254-44562276 CCCTTATTAGCTGTGTTCCTAGG - Intronic
1180930621 22:19588147-19588169 TCCTTTGAAGATGTGTTCTTGGG - Intergenic
1182151057 22:28027520-28027542 TCCTTGGCCCCTTTGTTCCTTGG - Intronic
1202734554 2_KI270716v1_random:128945-128967 TCCTTTGTCACCGTATTCCTCGG - Intergenic
949667914 3:6362865-6362887 TCCCTTGTTACTGTATTCCTAGG + Intergenic
950549798 3:13659213-13659235 TCCTTTCTCTCTGTGTGCTTGGG + Intergenic
951930361 3:27959341-27959363 TCATTTTTAGCTGTATTCCTAGG + Intergenic
957706166 3:83788209-83788231 TCCCTTGTGGGTGAGTTCCTTGG + Intergenic
958488139 3:94738405-94738427 TCCTTTGACATTGTTTTCCTTGG - Intergenic
958943914 3:100343198-100343220 TCCTTTGTCTTTGCCTTCCTTGG + Intronic
959104813 3:102053232-102053254 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
959760087 3:109951734-109951756 TCATTAGTCCCTGAGTTCCTGGG - Intergenic
960697433 3:120409770-120409792 TCCTATCTCCCTGTGTTGCTGGG - Intronic
964339222 3:155690737-155690759 TCCTTTTTCCATGTGCTCCTTGG + Intronic
966630214 3:182064881-182064903 TCCTTAGTTGCTGATTTCCTGGG + Intergenic
966654502 3:182340031-182340053 TCCCTTGTTTCTGTGTTCCTAGG - Intergenic
966854151 3:184182735-184182757 CCCATTGTCCCTGTGTTCCCAGG + Exonic
967494859 3:190131234-190131256 TCCCTTGTCACTCTGTTCCTTGG + Intergenic
968365453 3:198182084-198182106 TCTTTTGTCACTGTGTTCAGAGG - Intergenic
968848296 4:3060043-3060065 TCCTGAGTAGCTGTGTTCCTGGG + Intergenic
970107367 4:12599883-12599905 TCCTTGTTAGCTGTATTCCTGGG - Intergenic
970599257 4:17627915-17627937 TCTTTTGCCCCGGTGTTCCTTGG + Exonic
973802260 4:54490978-54491000 TCATTTGTCTTTGTGTCCCTTGG + Intergenic
977002023 4:91516922-91516944 CCCTATGTAGCTGTATTCCTAGG + Intronic
979362325 4:119779499-119779521 TCCTTGTTCGTTGTATTCCTGGG + Intergenic
979477551 4:121175875-121175897 ACCTATGTCTCTGTTTTCCTGGG + Intronic
980208822 4:129758284-129758306 TCCTTTGTCCCTCTCTTACTTGG + Intergenic
981129831 4:141146245-141146267 GCCTTTGACCCTGTTTTCCTAGG + Intronic
983002569 4:162435813-162435835 TCTTGTTTAGCTGTGTTCCTAGG + Intergenic
984094384 4:175415573-175415595 TCCTCTCTTGCTGTCTTCCTTGG - Intergenic
986830360 5:11570301-11570323 TCCTTTGTCCCTCTCTTCCGTGG + Intronic
987431369 5:17837895-17837917 CCCTTGTTAGCTGTGTTCCTAGG + Intergenic
987454284 5:18123774-18123796 CCCTTTTTAGCTGTATTCCTAGG - Intergenic
988056335 5:26102306-26102328 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
989029233 5:37100828-37100850 CCCTTGTTAGCTGTGTTCCTAGG + Intergenic
989334387 5:40298471-40298493 TCCCTTGTAGCTGGATTCCTAGG + Intergenic
989489634 5:42035038-42035060 CCCTTTTTAGCTGTATTCCTAGG + Intergenic
990619582 5:57545362-57545384 CCCTTGTTAGCTGTGTTCCTAGG + Intergenic
991441410 5:66653782-66653804 TCATTTGTCTCTTTCTTCCTAGG + Intronic
992520520 5:77545859-77545881 TCCATTGTCCCTGTGCTACTGGG + Intronic
993043104 5:82837520-82837542 TCCTTTCTCTCTGTGTCCCTTGG - Intergenic
993170102 5:84408385-84408407 TCATTTATCACTGTGTTCCTTGG + Intergenic
993181287 5:84556280-84556302 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
994234719 5:97348618-97348640 TCCTGTGTAGCTGTGTAGCTGGG + Intergenic
994409080 5:99383470-99383492 TCCTGGGTAGCTGTATTCCTAGG - Intergenic
994475357 5:100261724-100261746 TCCTTTGTTCCTTGGTTCCTTGG + Intergenic
995454739 5:112339155-112339177 TCAAATGTGGCTGTGTTCCTTGG + Intronic
995593662 5:113725968-113725990 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
996181763 5:120428127-120428149 TCCTTGTTGGCTGTGTTCCTAGG + Intergenic
996660511 5:125997071-125997093 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
996687867 5:126304027-126304049 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
997794889 5:136798888-136798910 TCCTTAGTAGATGTATTCCTAGG - Intergenic
998294662 5:140955865-140955887 CCCTTTTTAGCTGTATTCCTAGG + Intronic
998338471 5:141394929-141394951 GCCTTTGTCGCTGTGCTTCTGGG + Exonic
998352487 5:141510699-141510721 TCCTTACTCACTGTGATCCTGGG - Intronic
999828101 5:155293296-155293318 TCCTTTGTCACTTGGTTTCTTGG - Intergenic
1000798630 5:165696125-165696147 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1001851072 5:174966155-174966177 TCCTATTTAGCTGTATTCCTAGG + Intergenic
1001970951 5:175954508-175954530 TCCTTTGTGGCTGTCTCCCCAGG - Intronic
1002246491 5:177889269-177889291 TCCTTTGTGGCTGTCTCCCCAGG + Intergenic
1003771341 6:9305761-9305783 AGCTTTGTCGTTATGTTCCTAGG - Intergenic
1004103034 6:12634619-12634641 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1006240700 6:32675551-32675573 TCCTTGTTGGCTGTATTCCTAGG + Intergenic
1009843704 6:69109400-69109422 TCCTTTGTCCCTTTGTACCTAGG + Intronic
1010036886 6:71336065-71336087 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1010097678 6:72065514-72065536 TCCTTGGTCTCTTTTTTCCTCGG - Intronic
1010520146 6:76822679-76822701 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1011231380 6:85165522-85165544 TCCTTTGTCCCTTTGGGCCTAGG - Intergenic
1012412320 6:98972755-98972777 TTCTTAGTTGCTGTGTTCTTTGG - Intergenic
1012713997 6:102646124-102646146 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1013423565 6:109989240-109989262 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
1013716245 6:112966864-112966886 ACCTTTTTAGCTGTATTCCTAGG - Intergenic
1013896811 6:115098891-115098913 CCCTTTTTAGCTGTATTCCTAGG + Intergenic
1014328005 6:120023884-120023906 TTCCTTGTTGCTGTATTCCTAGG + Intergenic
1015192981 6:130492237-130492259 GCCTTGTTAGCTGTGTTCCTAGG + Intergenic
1015719158 6:136223443-136223465 TCCCTTGTAGCTGTATTCCTTGG - Intergenic
1016198542 6:141377696-141377718 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1016423338 6:143908494-143908516 TCCTTGTTAGCTGTATTCCTGGG + Intronic
1018165123 6:161086562-161086584 TTCTTTGTAACTGTGATCCTAGG + Exonic
1018325697 6:162665456-162665478 CCCTTGTTGGCTGTGTTCCTAGG - Intronic
1018513303 6:164550362-164550384 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1022542244 7:31148158-31148180 CCCTTGTTAGCTGTGTTCCTGGG - Intergenic
1022633953 7:32113903-32113925 CCCTTGTTAGCTGTGTTCCTAGG - Intronic
1023416389 7:39937103-39937125 TCCTTTGTCTTTGTGTTACTTGG - Intergenic
1028329251 7:89568238-89568260 TCTTTTGTGGCTTTATTCCTGGG + Intergenic
1029673145 7:102047860-102047882 TCCTTTGGCCATGTGGTCCTTGG - Intronic
1030412846 7:109203500-109203522 TCCTTCCTCCCTGTGTTTCTTGG - Intergenic
1031026784 7:116687861-116687883 CCCTTTGTCTCTCTGTCCCTGGG + Intronic
1035711464 8:1719259-1719281 TCCCTTGTAGTTGTATTCCTAGG - Intergenic
1035983449 8:4399255-4399277 TCCTTTGTTGCTGTTTTTGTGGG - Intronic
1036795684 8:11754882-11754904 TTCTTTCTCGCTGAGTTCCAGGG + Intronic
1036844649 8:12156898-12156920 TCCCTCTTCGCTGTGTACCTGGG - Intergenic
1036866019 8:12399231-12399253 TCCCTCTTCGCTGTGTACCTGGG - Intergenic
1037137455 8:15480073-15480095 TCCTTGTTAGCTGTATTCCTAGG - Intronic
1037191553 8:16132206-16132228 CCCTTTTTAGCTGTATTCCTAGG + Intronic
1037463248 8:19134661-19134683 TCCATTGTCGTTTTGCTCCTGGG + Intergenic
1037757748 8:21722288-21722310 TCCTAAGGCGCTATGTTCCTGGG - Intronic
1038461337 8:27719954-27719976 GGCTTTTTCTCTGTGTTCCTTGG - Intergenic
1038469168 8:27797633-27797655 TCCTCTCTTGCTGTCTTCCTTGG + Intronic
1038518626 8:28209483-28209505 CCCTTTTTAGCTGTATTCCTAGG - Intergenic
1039125162 8:34192960-34192982 CCCTTGTTAGCTGTGTTCCTAGG + Intergenic
1040073528 8:43206894-43206916 ACCTTTGCCGATGGGTTCCTGGG + Intergenic
1040785040 8:51155562-51155584 TCCCTTTTTGCTGTTTTCCTAGG + Intergenic
1040868578 8:52076744-52076766 TCTTTGTTGGCTGTGTTCCTTGG + Intergenic
1041129579 8:54683521-54683543 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1042764415 8:72304816-72304838 CCCTGGGTAGCTGTGTTCCTAGG + Intergenic
1043025327 8:75060215-75060237 CCCTTTTTAGCTGTATTCCTAGG - Intergenic
1044508183 8:93045240-93045262 CCCTTGTTAGCTGTGTTCCTAGG + Intergenic
1045389151 8:101698206-101698228 CCCTTGTTAGCTGTGTTCCTAGG - Intronic
1045953138 8:107874408-107874430 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1046709247 8:117491052-117491074 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1046940796 8:119929340-119929362 AGCTGTGTCACTGTGTTCCTGGG + Intronic
1047575799 8:126153814-126153836 TCCTTGGTTGATGTTTTCCTAGG - Intergenic
1049172057 8:141167525-141167547 CACTTAGTCGCTGTGTACCTGGG + Intronic
1051072654 9:13191097-13191119 TCATTTGTATCTGTGGTCCTAGG - Intronic
1051172944 9:14337988-14338010 CCCTTTGTCCCTCTGTTCCTCGG + Intronic
1052780013 9:32772175-32772197 TCCTTGTTAGCTGTGTTTCTAGG + Intergenic
1054938773 9:70717144-70717166 TCCCTTTCAGCTGTGTTCCTTGG + Intronic
1054940464 9:70735137-70735159 TCCCTTTCAGCTGTGTTCCTTGG + Intronic
1057554268 9:96074959-96074981 TCCTTTGTCAGTGCGTTCTTTGG + Intergenic
1058313774 9:103538459-103538481 TCCCTAGTTGCTGTATTCCTAGG - Intergenic
1060053153 9:120391350-120391372 TCCTTTGTCGCTGTGTTCCTCGG - Intronic
1060242361 9:121914879-121914901 ACCTGTGTCACTGTGCTCCTGGG + Intronic
1062027221 9:134346191-134346213 TCCTGTTCCGCTGTGGTCCTAGG + Intronic
1062692727 9:137852056-137852078 TTCTGTGTCTCTGTGTTCCAGGG + Intronic
1062749821 9:138244951-138244973 TCTTTTGTCACTGTGTTCAGAGG - Intergenic
1203429453 Un_GL000195v1:77594-77616 TCCTTCTTAGCTGTATTCCTTGG - Intergenic
1203659513 Un_KI270753v1:28474-28496 TTCTTTGTCACTGTGTGGCTGGG - Intergenic
1186014544 X:5176180-5176202 TCCTTTGTCTCTGTGTTAAGTGG - Intergenic
1186137732 X:6536816-6536838 TCCTTTGTACCTTTTTTCCTGGG + Intergenic
1186933661 X:14423062-14423084 GCCTGTGTCTCTGTATTCCTTGG + Intergenic
1187413482 X:19071504-19071526 TCTTTTGTCTCTGGTTTCCTTGG - Intronic
1187640454 X:21282920-21282942 TGATTTGTAGCTGTATTCCTAGG - Intergenic
1188239745 X:27771284-27771306 CCATTTGTCTCTGTGTCCCTTGG - Intergenic
1189399611 X:40655030-40655052 TCCATTTTAGCTGTGTTGCTTGG + Exonic
1189651953 X:43199520-43199542 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1192756733 X:74054247-74054269 CCCTTTTTAGCTGTCTTCCTAGG - Intergenic
1193385318 X:80864171-80864193 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1193589310 X:83367805-83367827 TCCTTGTTTGCTGTATTCCTAGG + Intergenic
1193719082 X:84967096-84967118 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1194170308 X:90572889-90572911 TCTTTTTTAGCTGTATTCCTAGG - Intergenic
1195813147 X:108856242-108856264 TCCCTTGTTACTGTATTCCTAGG - Intergenic
1196242712 X:113362082-113362104 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1196513450 X:116542282-116542304 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1196561144 X:117150211-117150233 TCCTGGGTAGCTGTATTCCTAGG + Intergenic
1196907184 X:120449231-120449253 TCCTTTGTCACTTTGTGCCTGGG - Intronic
1196926451 X:120638039-120638061 TCCCTGGTTGCTGTATTCCTAGG - Intergenic
1197136631 X:123068153-123068175 CCCTTGGTAGCTGTATTCCTAGG - Intergenic
1197456528 X:126683055-126683077 CCCTTGTTAGCTGTGTTCCTAGG - Intergenic
1197516210 X:127432976-127432998 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1197532937 X:127653046-127653068 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1198285507 X:135186229-135186251 GCATCTGTCGCTGTGTCCCTGGG + Intergenic
1198785797 X:140286440-140286462 TCCTTGTTAGCTGTATTCCTAGG + Intergenic
1199079900 X:143565344-143565366 TCCTTGTTAGCTGTATTCCTAGG - Intergenic
1199786202 X:151107659-151107681 CCCTTTTTAGCTGTATTCCTAGG + Intergenic
1200093179 X:153645152-153645174 CCCTTTCTCAGTGTGTTCCTGGG - Intronic
1200516553 Y:4150655-4150677 TCTTTTTTAGCTGTATTCCTAGG - Intergenic
1201482048 Y:14450535-14450557 TCCTTTGTGTCTGGGATCCTAGG - Intergenic