ID: 1060053155

View in Genome Browser
Species Human (GRCh38)
Location 9:120391378-120391400
Sequence GCTGGGGCCAGTCTAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060053155_1060053163 1 Left 1060053155 9:120391378-120391400 CCCAAATCTAGACTGGCCCCAGC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data
1060053155_1060053164 22 Left 1060053155 9:120391378-120391400 CCCAAATCTAGACTGGCCCCAGC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1060053164 9:120391423-120391445 GGCCTGCCCAACTCAGTCCATGG No data
1060053155_1060053162 0 Left 1060053155 9:120391378-120391400 CCCAAATCTAGACTGGCCCCAGC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1060053162 9:120391401-120391423 ACAGAGCTGGGACTCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060053155 Original CRISPR GCTGGGGCCAGTCTAGATTT GGG (reversed) Intronic
900330245 1:2130584-2130606 GCTGGGCCCCCTGTAGATTTTGG - Intronic
902528513 1:17075365-17075387 GCTGTGGCTAGTCTGAATTTAGG + Intronic
905900986 1:41581858-41581880 GCTGGGGACAGTCAACATGTGGG + Exonic
907487272 1:54786755-54786777 GCTGGGGCCAGACTGGGTATGGG + Intronic
908489844 1:64632557-64632579 TCTGGGGTCAGTCTTGGTTTAGG - Intronic
910629247 1:89339391-89339413 ACTGGGGCCTGTCTAGAGTGAGG - Intergenic
911014470 1:93317560-93317582 GCTGAGCCCAGCCTAGATTGTGG + Intergenic
911085410 1:93973349-93973371 GCTGAGGCCACTCAAGCTTTGGG - Intergenic
912322314 1:108725809-108725831 GCTTGGTCCAGTGTAGATCTGGG + Exonic
912390313 1:109298115-109298137 TCTGGGGCCAGTGCAGGTTTTGG - Intronic
915822038 1:159034626-159034648 GCTGGGGCCTGTGGAGAGTTGGG - Intronic
917158592 1:172031386-172031408 ACTGGGGCCAGTCAGGATGTTGG + Intronic
922000785 1:221476185-221476207 GCTGGGGAAAGTGAAGATTTAGG - Intergenic
923250972 1:232179448-232179470 GCTGAGGCCAGTAGAAATTTTGG + Intergenic
1062846524 10:711431-711453 GCTGGGCCCACACTAGATCTTGG - Intergenic
1063250638 10:4270055-4270077 GCTTGGGCCACCCTAGCTTTAGG + Intergenic
1064010338 10:11730357-11730379 GCTGGGGCCTGGCTGAATTTGGG - Intergenic
1066612647 10:37265890-37265912 GCTGGACACAGTCTAGACTTGGG - Intronic
1067190015 10:44061191-44061213 GCTGAGGCCAGTGCAGAGTTGGG + Intergenic
1070067082 10:73047025-73047047 GCTGGAGCCAGAATAAATTTAGG + Exonic
1073467514 10:103702884-103702906 GATGGGGCCAGTGTAGCTTGAGG - Intronic
1074519935 10:114210365-114210387 TCTTGGACCAGTCTAGCTTTTGG + Intronic
1077150957 11:1072985-1073007 GCTGGGGACACTCTCGCTTTGGG + Intergenic
1077898047 11:6468888-6468910 GCAGGAGCGAGTCTAGATTTGGG + Intronic
1081637073 11:44727899-44727921 GCTCGGGCACGTCCAGATTTAGG + Intronic
1083848902 11:65354254-65354276 GCTTGGGCCAGTAATGATTTAGG - Intergenic
1091357181 11:134946150-134946172 GCTGGGGCCAGCCCAGGCTTCGG - Intergenic
1091383815 12:79188-79210 GCTGTGGCCAGACCAGCTTTGGG + Intronic
1092583451 12:9873442-9873464 GCTTGGGCCAAACTAGATTAGGG - Intergenic
1096026545 12:48368929-48368951 GCCAGGGCCAGTCTTGAGTTGGG - Intergenic
1096340980 12:50798938-50798960 GTAGTGGCCAGTCTAGAATTTGG - Intronic
1097785699 12:63756549-63756571 GTTGGTGGCAGTCTTGATTTTGG + Intergenic
1098850164 12:75586846-75586868 TGTGAGGCCAGTCTAGATTTGGG + Intergenic
1102482997 12:113236687-113236709 GCTGGGGGCAGATTGGATTTGGG + Intronic
1104498150 12:129260125-129260147 GCTTGGGACACTCTAAATTTGGG + Intronic
1121385476 14:93518464-93518486 GCTGGGGCCTATCAAGTTTTTGG + Intronic
1123580411 15:21710150-21710172 GCGGGGGCCAGTCTTGGTGTTGG + Intergenic
1123617059 15:22152773-22152795 GCGGGGGCCAGTCTTGGTGTTGG + Intergenic
1128173257 15:65531057-65531079 GCTGGGGCCCTTCGAGATGTGGG + Intronic
1128182926 15:65620956-65620978 GCTGGGGTCACTCTGGATGTTGG - Intronic
1129606251 15:77026469-77026491 GCTGGGGCCAGGCTAGGCCTGGG + Intronic
1129865837 15:78907945-78907967 GTTGGGTCCAGTCTCTATTTTGG + Intergenic
1131051279 15:89349686-89349708 GCTGGGGCCAGTGTGGGTTCAGG - Intergenic
1131993132 15:98109629-98109651 GGTGAGGCAGGTCTAGATTTGGG - Intergenic
1202989281 15_KI270727v1_random:444395-444417 GCGGGGGCCAGTCTTGGTGTTGG + Intergenic
1135104775 16:19639452-19639474 GCTGGGACCAGTTAACATTTTGG - Intronic
1136551152 16:30983307-30983329 GCTGGGGCAAGTCTGGGGTTGGG - Intronic
1136775099 16:32867678-32867700 GCTTTGGCCAGCCTAGATTGAGG + Intergenic
1136895519 16:33993834-33993856 GCTTTGGCCAGCCTAGATTGAGG - Intergenic
1137010508 16:35315886-35315908 GCTGGGCTCAGAGTAGATTTGGG + Intergenic
1139607933 16:68033153-68033175 GAAGGGGCAAGTGTAGATTTTGG + Intronic
1140937766 16:79690882-79690904 GCTGGGGCCAGGCAAGATAAAGG + Intergenic
1203077517 16_KI270728v1_random:1129787-1129809 GCTTTGGCCAGCCTAGATTGAGG + Intergenic
1142484489 17:237668-237690 GCTGTGGCCTGGCCAGATTTGGG - Intronic
1144998249 17:19285738-19285760 GCTGGGACCAGTCGCCATTTGGG - Exonic
1146632762 17:34482859-34482881 GCTGGAGCCAGGGTAGATATTGG - Intergenic
1148053457 17:44780231-44780253 GCTGGGGCCAGGGCAGATGTGGG + Exonic
1149176571 17:53878958-53878980 GTTTGGGCAAGTTTAGATTTCGG + Intergenic
1150387970 17:64775601-64775623 GGTGGGGCCTGCCTGGATTTAGG - Intergenic
1152469474 17:80482849-80482871 GCAGGGGCCAGGGTAGATGTGGG + Intergenic
1156501838 18:37565158-37565180 GCTGGGGCAAGACTGGGTTTTGG - Intronic
1158561102 18:58514453-58514475 GCTTGGGCCAGTAAATATTTAGG + Intronic
1158719063 18:59907552-59907574 ACTGGGGTAAGGCTAGATTTGGG + Intergenic
1158945947 18:62447123-62447145 GCTGGAGCCAGTCTCCATTGAGG + Intergenic
1160663903 19:313949-313971 GCTGTGGACAGCCTAGATCTGGG + Intronic
1161092826 19:2371172-2371194 GCTGGGGAGAGTCTTGGTTTAGG - Intergenic
1161684975 19:5698103-5698125 GGTGGGGCCAGTGCAGCTTTGGG - Intronic
1162800038 19:13105167-13105189 GCTGGGGCCAGGCAAGTGTTTGG - Intronic
1164561754 19:29297131-29297153 GCTGAGGCCAGGCTAGATCGAGG - Intergenic
1167224510 19:48228687-48228709 GTGGGGGCCATTCTAGATTTTGG + Intronic
925013691 2:505463-505485 GCTGGAGCCAGCCTGGATTCTGG + Intergenic
927053313 2:19350168-19350190 CCTGGGGCCAGTCAAGATTTTGG + Intergenic
927697374 2:25247500-25247522 GCTGGGGGCAGTCTGGAATTGGG - Intronic
929919269 2:46161015-46161037 GCTTGGGACAGCCCAGATTTAGG + Intronic
931315524 2:61127253-61127275 GCTGGGGACAGTCCAGATATTGG - Intronic
933453182 2:82483596-82483618 GTTGTGTTCAGTCTAGATTTTGG + Intergenic
934962968 2:98694056-98694078 GCTGGGGCCAGGCTGGAGCTGGG - Intronic
940967046 2:159850303-159850325 TCTGGGGCCAGGTTAGTTTTAGG - Intronic
940990500 2:160091724-160091746 GCTAGGACCAGTTCAGATTTGGG - Intergenic
946748609 2:222870558-222870580 GCTAGGGCCAGTGGAGGTTTGGG + Intronic
948083634 2:235227794-235227816 GCAGAGGTCAGTGTAGATTTTGG - Intergenic
1172700332 20:36849750-36849772 GCGGGGGGAAGTTTAGATTTGGG + Intronic
1172989346 20:39021327-39021349 GATGGGGCCAGTCTTGACCTTGG + Intronic
1173060485 20:39655558-39655580 GCTTGGGCCAGGCTAACTTTGGG + Intergenic
1173691004 20:44960799-44960821 GCTGAGACCAGACAAGATTTAGG + Intergenic
1174450506 20:50617152-50617174 GGTGGGGGGCGTCTAGATTTGGG + Intronic
1174451494 20:50623536-50623558 CCTGGGGCCTCTCTAGTTTTGGG + Intronic
1177211518 21:18077391-18077413 GCTGGAGCAAGTTAAGATTTTGG + Intronic
1180063130 21:45396717-45396739 GCTGGGGGCACCCTTGATTTCGG + Intergenic
1182787563 22:32920344-32920366 TGTGGGGCCAGGCTAGAATTTGG + Intronic
1183365496 22:37404532-37404554 GGTGGGGCCAGTTGAGCTTTAGG + Intronic
1184309025 22:43629137-43629159 GGTGGGGCCAGCCTGGATTCTGG + Intronic
950828024 3:15846097-15846119 GCTGGGACGAGTTAAGATTTTGG - Intronic
951349210 3:21584810-21584832 CCTGGAGACAGTCTAGAATTAGG - Intronic
952389273 3:32865875-32865897 GCTGGAGGCAGTGGAGATTTTGG + Intronic
952534302 3:34294180-34294202 GCTGGGGCCAGAGCAGCTTTGGG - Intergenic
956738468 3:72256890-72256912 GCTGGTGCCAGGAGAGATTTGGG - Intergenic
960842408 3:121973578-121973600 GCTTGGACCAGGCTAAATTTAGG + Intergenic
962254979 3:133864433-133864455 GATGGGGCCAGTATAGAGGTGGG + Intronic
963410376 3:144920167-144920189 GCTGATGGTAGTCTAGATTTAGG - Intergenic
970097218 4:12477641-12477663 GCTGGGACAAGTCAAGACTTTGG - Intergenic
971239363 4:24873801-24873823 GGTGGGGAGAGTCTACATTTAGG - Intronic
974107789 4:57490425-57490447 GTTGGAGTCAGTTTAGATTTCGG + Intergenic
981669905 4:147275111-147275133 GCTGGGGCCAGTCTAGAGCCTGG + Intergenic
982440425 4:155428731-155428753 TCTGGGACAGGTCTAGATTTGGG + Intergenic
985941250 5:3138278-3138300 GCTGGGGCTTGTCTGGTTTTGGG - Intergenic
987927420 5:24361017-24361039 ACTGGGGCCTGTCGAGATGTGGG + Intergenic
993658108 5:90597297-90597319 TCTGTGGCCATTATAGATTTTGG + Intronic
995013437 5:107283768-107283790 GCTTGAGTCAGACTAGATTTGGG + Intergenic
998956659 5:147445743-147445765 TGTTTGGCCAGTCTAGATTTTGG + Intronic
1001826631 5:174750947-174750969 GCTGGGGCCTGCCAATATTTTGG - Intergenic
1001972385 5:175967353-175967375 GCTGGGACCAGTAAAGATCTGGG + Intronic
1002245052 5:177876424-177876446 GCTGGGACCAGTAAAGATCTGGG - Intergenic
1002457016 5:179351097-179351119 GCTGGGGCCAGGCTGGAGATGGG - Intergenic
1008465439 6:51825266-51825288 CCTGAGGTCAGCCTAGATTTAGG - Intronic
1012950292 6:105511229-105511251 TCTGGGGCCCAGCTAGATTTGGG - Intergenic
1017019483 6:150128753-150128775 GGTGGAGCCATTATAGATTTTGG + Intergenic
1018043483 6:159945601-159945623 GCTGGGCTCAGTCTACACTTCGG - Intergenic
1019898356 7:4000389-4000411 GCTGGGCCAAGACTAGCTTTTGG + Intronic
1024633923 7:51271289-51271311 GCAGGAGCCAGTCTAGGTTTAGG - Intronic
1025610508 7:63072510-63072532 GCTGGGCTCAGTGTAGATTTGGG - Intergenic
1028226765 7:88261085-88261107 CCTGGGGCCAGGCCAGGTTTTGG - Intergenic
1031912665 7:127534185-127534207 TGTGGGGACAGTCTAGTTTTAGG - Intergenic
1035308068 7:157945945-157945967 GCTGGGCCCAGTCCAGGTTCTGG + Intronic
1036644096 8:10601400-10601422 GCGTGGGCAAGTCTAGATGTGGG + Intergenic
1040702107 8:50078717-50078739 GCTGGGGCCTGTCGAGGGTTGGG - Intronic
1045106162 8:98894863-98894885 CCTGGTGCCATTCTAGATTCTGG - Intronic
1052648895 9:31273930-31273952 GCTGGGACAAGTTAAGATTTGGG + Intergenic
1056507951 9:87275271-87275293 GCTGGTGCCAGACTAGAATTAGG - Intergenic
1059736498 9:117105159-117105181 CCTAAGGCCAGCCTAGATTTGGG - Intronic
1060053155 9:120391378-120391400 GCTGGGGCCAGTCTAGATTTGGG - Intronic
1062528391 9:136987962-136987984 GTGGGGGCCAGTCAAGTTTTGGG - Intergenic
1062549257 9:137078372-137078394 GCTGGGGCCAGGCCCCATTTTGG - Intronic
1185928481 X:4173479-4173501 GCTGGGGCCAGTATAGTTTTGGG - Intergenic
1189456061 X:41191357-41191379 CCTGGGGCCAGTATGTATTTGGG - Intronic
1190703225 X:53003826-53003848 TCTGGGGCCAGACTAGACCTGGG - Intergenic
1191046762 X:56146548-56146570 GCTGGGGCCTGTCTGGATGTGGG + Intergenic
1191807289 X:65148421-65148443 GCTGGGGCCAGTCTGGTCCTGGG + Intergenic
1193893496 X:87081407-87081429 ACTGGGGCCTGTCTGGAGTTGGG - Intergenic
1198120936 X:133591883-133591905 GCTGGGACCAGGCAACATTTTGG + Intronic