ID: 1060053156

View in Genome Browser
Species Human (GRCh38)
Location 9:120391379-120391401
Sequence TGCTGGGGCCAGTCTAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060053156_1060053163 0 Left 1060053156 9:120391379-120391401 CCAAATCTAGACTGGCCCCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data
1060053156_1060053162 -1 Left 1060053156 9:120391379-120391401 CCAAATCTAGACTGGCCCCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1060053162 9:120391401-120391423 ACAGAGCTGGGACTCACATGTGG No data
1060053156_1060053164 21 Left 1060053156 9:120391379-120391401 CCAAATCTAGACTGGCCCCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1060053164 9:120391423-120391445 GGCCTGCCCAACTCAGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060053156 Original CRISPR TGCTGGGGCCAGTCTAGATT TGG (reversed) Intronic
902238869 1:15075066-15075088 TGCAGGGGCCAGCCCAGAATAGG + Intronic
903269482 1:22178515-22178537 AGGTGGGGCCAGTCAAGACTAGG - Intergenic
904540006 1:31226462-31226484 GGCTGGGGCCAGGCCAGATGGGG + Intronic
907990028 1:59571481-59571503 TGCTGGGGGAAGTATAAATTGGG + Intronic
913573458 1:120144461-120144483 AGCTGATGCCAGTTTAGATTGGG + Intergenic
914294716 1:146309262-146309284 AGCTGATGCCAGTTTAGATTGGG + Intergenic
914555757 1:148760045-148760067 AGCTGATGCCAGTTTAGATTGGG + Intergenic
915891406 1:159777426-159777448 TGCTGGGGCCTGTCTGGGGTGGG - Intergenic
919826912 1:201509569-201509591 AGCTCGGGCCAGTCTAGATATGG - Intergenic
921564664 1:216702399-216702421 TGTTGGGGGAAGTCTAGAGTGGG - Intronic
924637991 1:245807034-245807056 TTCTGGGACCAGTCAAGAGTGGG + Intronic
1064010339 10:11730358-11730380 TGCTGGGGCCTGGCTGAATTTGG - Intergenic
1066612648 10:37265891-37265913 TGCTGGACACAGTCTAGACTTGG - Intronic
1070253618 10:74795381-74795403 TGCTGGTGCCAGTGTAAAGTGGG - Intergenic
1072733436 10:97863728-97863750 TGGGGGGGCCAGTCCAGACTTGG - Intronic
1075016530 10:118913876-118913898 TGCTGGGGCCAGTCTGGAACGGG - Intergenic
1077898046 11:6468887-6468909 TGCAGGAGCGAGTCTAGATTTGG + Intronic
1078248928 11:9601374-9601396 TGCTGGGGCCACTCAGCATTCGG - Intergenic
1080922885 11:36726422-36726444 TGCTGGGGCCAGCCTCTATAAGG + Intergenic
1082656160 11:55859672-55859694 TTATGGGGCCAGTCTAAAATGGG - Intergenic
1092583452 12:9873443-9873465 GGCTTGGGCCAAACTAGATTAGG - Intergenic
1097422722 12:59400274-59400296 AGCTGGGGCTATTTTAGATTAGG - Intergenic
1098850163 12:75586845-75586867 ATGTGAGGCCAGTCTAGATTTGG + Intergenic
1101437302 12:104675067-104675089 TGCTGTGGTCAGTCTAGTATAGG + Intronic
1101495886 12:105253904-105253926 TGCTGGGCCCAGCCTAGGTCAGG + Intronic
1102482996 12:113236686-113236708 TGCTGGGGGCAGATTGGATTTGG + Intronic
1102630734 12:114276873-114276895 GTCTGGGGCCAGTCAACATTGGG + Intergenic
1107970113 13:45633344-45633366 TGCTTGGGACATTCCAGATTGGG + Intergenic
1113767797 13:112891814-112891836 TGCTGGGGCCAGGCTTGTTAGGG - Intergenic
1115722136 14:36174764-36174786 TGTTGGGGTGAGTCTAGAGTTGG + Intergenic
1116893033 14:50287441-50287463 TGCTGGCCCCATTATAGATTTGG - Intronic
1122009816 14:98736813-98736835 TGCTGTGGCCAGTGTAGACAGGG + Intergenic
1122798166 14:104216711-104216733 TGATGGGGGCAGCCTAGACTGGG - Intergenic
1125667355 15:41442076-41442098 TGCTGTGGACATTTTAGATTGGG + Intronic
1131258953 15:90878727-90878749 GGCTGGGGTCATTCAAGATTGGG - Intronic
1131993133 15:98109630-98109652 TGGTGAGGCAGGTCTAGATTTGG - Intergenic
1132682571 16:1149198-1149220 TGCAGGGGCCAGTCTAGGCAGGG + Intergenic
1132744145 16:1429731-1429753 TGCTGGGGCCAGGCCAGGCTGGG + Intergenic
1136551153 16:30983308-30983330 TGCTGGGGCAAGTCTGGGGTTGG - Intronic
1137384039 16:48025051-48025073 TGCTGGGAACATTCTAGACTGGG - Intergenic
1141816953 16:86417437-86417459 TGCTGGGCCTAGGCTTGATTTGG - Intergenic
1147687652 17:42296489-42296511 TTCTGGGGTCAGTCTGGAATGGG - Intronic
1148053456 17:44780230-44780252 TGCTGGGGCCAGGGCAGATGTGG + Exonic
1149641034 17:58202975-58202997 AGCTGTGGCCAGTCAATATTGGG - Intronic
1149673033 17:58432562-58432584 TGCTGGGGCTGGACTAGATGAGG + Intronic
1150003281 17:61455140-61455162 GGCCGGGGCCAGTCTGGGTTGGG - Intronic
1152469473 17:80482848-80482870 TGCAGGGGCCAGGGTAGATGTGG + Intergenic
1162615473 19:11797629-11797651 TGCTGAGGCCAGTCTGGAGCCGG + Intergenic
1165106668 19:33474117-33474139 TGCTGGGGCCAGGGTATAGTAGG - Intronic
1166461122 19:42989380-42989402 TGCTGTGACTAGTCTAGAATGGG - Intronic
1168281068 19:55305602-55305624 TGCGGGGGCCAGGCTCGATGGGG - Intronic
927697375 2:25247501-25247523 GGCTGGGGGCAGTCTGGAATTGG - Intronic
929432378 2:41898038-41898060 TCCTGAGGCCAGTATAGATAAGG - Intergenic
931606987 2:64062408-64062430 TACTGGGTCCATTCTAGGTTCGG + Intergenic
937094356 2:119225725-119225747 TGCTGGGGATAGTCTGGCTTTGG + Intronic
939811473 2:146838111-146838133 AGCTGAGGCCATTCTAGAATAGG + Intergenic
941326014 2:164115157-164115179 TGCTGGGGCCATCCTAGACTAGG - Intergenic
942449493 2:176100163-176100185 TGCAGGAGCCAGGCTAGACTCGG - Exonic
1173570379 20:44071871-44071893 TGCCGGGGCCAGTCTACGGTCGG + Intergenic
1180317145 22:11285190-11285212 TGCTTGGGCCAGGCTAGAACAGG + Intergenic
1182426420 22:30275532-30275554 TGCTGGGCACAGGCTAGATGTGG + Intergenic
949579216 3:5370366-5370388 TGCTGTGGGCAGTGTAGAATTGG + Intergenic
953657832 3:44867352-44867374 TGGTGGGGTCAGACTAGATCAGG - Intronic
954293318 3:49661085-49661107 TGCTGGGGCCAGGGTAGGTGGGG - Exonic
954393003 3:50277138-50277160 TGCTGGGGCCATTCCAGCTTTGG - Intronic
960668883 3:120137692-120137714 TGCTAGGGACATTATAGATTTGG - Intergenic
978836012 4:113150345-113150367 TGCTGTGGCCAGTGTCCATTGGG + Intronic
982064270 4:151639418-151639440 TGCTGGGCCAAGGCAAGATTTGG - Intronic
982440424 4:155428730-155428752 TTCTGGGACAGGTCTAGATTTGG + Intergenic
982666805 4:158274982-158275004 TGCTGAGGCCAGTCTACTCTGGG - Intergenic
991170297 5:63616586-63616608 TGATGCAGCCACTCTAGATTTGG - Intergenic
999278314 5:150347142-150347164 TCTTGGGGCCAGGCAAGATTAGG + Intergenic
999287976 5:150405496-150405518 AGCTGGGGGCAGTCAAGGTTGGG - Intronic
1001972384 5:175967352-175967374 TGCTGGGACCAGTAAAGATCTGG + Intronic
1002245053 5:177876425-177876447 TGCTGGGACCAGTAAAGATCTGG - Intergenic
1002581891 5:180214248-180214270 TCTTTGGGCCAGTCCAGATTGGG - Intergenic
1004227448 6:13799153-13799175 TGCTTATGCCAGTCTAGAGTGGG + Intronic
1007285968 6:40747664-40747686 TGAGGGGTTCAGTCTAGATTTGG - Intergenic
1007410472 6:41658421-41658443 TGGGGGAGCCAGTGTAGATTAGG + Intergenic
1012950293 6:105511230-105511252 TTCTGGGGCCCAGCTAGATTTGG - Intergenic
1014489935 6:122050296-122050318 TTCTTGGGCCAGTGTATATTTGG + Intergenic
1021896141 7:25237886-25237908 TGATTGGCCCAGTCTAGATAAGG + Intergenic
1025258123 7:57399178-57399200 AGCTGGGTTCAGTGTAGATTTGG + Intergenic
1025610509 7:63072511-63072533 AGCTGGGCTCAGTGTAGATTTGG - Intergenic
1031826834 7:126576104-126576126 TGCTGGGCCCTGTCTACATGGGG - Intronic
1031981165 7:128126350-128126372 TGCTGTGCCCAGTATATATTGGG - Intergenic
1033488288 7:141813600-141813622 TCCTGGGGGCTTTCTAGATTGGG - Intergenic
1034566395 7:151919102-151919124 TGCTGGGGCCACTCCAGCCTGGG + Intergenic
1038571155 8:28663895-28663917 TGCTGGCGGCAGGCTAAATTTGG + Intronic
1050967304 9:11821867-11821889 AGCTGGTGCCAGGCTATATTTGG - Intergenic
1052648894 9:31273929-31273951 TGCTGGGACAAGTTAAGATTTGG + Intergenic
1059736500 9:117105160-117105182 TCCTAAGGCCAGCCTAGATTTGG - Intronic
1060053156 9:120391379-120391401 TGCTGGGGCCAGTCTAGATTTGG - Intronic
1060254312 9:122013774-122013796 TGCTGGGGTCAGTGTAGCCTGGG - Intronic
1060413113 9:123412854-123412876 GGCTGGGGCAAGTCTGGATTTGG - Intronic
1062429780 9:136521799-136521821 TGCAGGGGCCAGGCCAGCTTGGG + Intronic
1062702353 9:137913955-137913977 TGCTGGGGCCAGACTCGAAGGGG + Intronic
1185928482 X:4173480-4173502 GGCTGGGGCCAGTATAGTTTTGG - Intergenic
1191046761 X:56146547-56146569 CGCTGGGGCCTGTCTGGATGTGG + Intergenic
1191807288 X:65148420-65148442 TGCTGGGGCCAGTCTGGTCCTGG + Intergenic
1193080866 X:77404757-77404779 TGCTGGGGCCAGGCTGAGTTGGG - Intergenic
1196594253 X:117524930-117524952 TGTTGAGGCCATTCCAGATTTGG - Intergenic
1197883122 X:131190183-131190205 TGCTGGGGCCAGTAAAGAAAGGG + Intergenic
1201073303 Y:10169323-10169345 TGCTTGGGCCAGGCTAGAACAGG - Intergenic