ID: 1060053163

View in Genome Browser
Species Human (GRCh38)
Location 9:120391402-120391424
Sequence CAGAGCTGGGACTCACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060053153_1060053163 29 Left 1060053153 9:120391350-120391372 CCGAGGAACACAGCGACAAAGGA 0: 1
1: 0
2: 0
3: 23
4: 296
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data
1060053156_1060053163 0 Left 1060053156 9:120391379-120391401 CCAAATCTAGACTGGCCCCAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data
1060053155_1060053163 1 Left 1060053155 9:120391378-120391400 CCCAAATCTAGACTGGCCCCAGC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060053163 Original CRISPR CAGAGCTGGGACTCACATGT GGG Intronic
No off target data available for this crispr