ID: 1060057343

View in Genome Browser
Species Human (GRCh38)
Location 9:120426140-120426162
Sequence CATGGTTAACAGAGTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060057343 Original CRISPR CATGGTTAACAGAGTGATGC AGG (reversed) Intronic
908074388 1:60498160-60498182 CATGTTTGAAAGAGGGATGCTGG - Intergenic
908896097 1:68901545-68901567 CTTTGTTACCAGAGTGATGTTGG - Intergenic
909550109 1:76889069-76889091 GATGGTTACCAGAGGGATGGGGG - Intronic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
912057407 1:105622385-105622407 CATTGTTTACAGACTGATTCTGG + Intergenic
912209262 1:107540905-107540927 CATGGTTTACAGGGTTATTCAGG + Intergenic
912843454 1:113059385-113059407 GCTGGTGAACAGAGTGAGGCTGG + Intergenic
915229662 1:154435980-154436002 CGTGGATGACACAGTGATGCTGG - Exonic
919948505 1:202340829-202340851 TTTGGTTAACATAGTGAGGCTGG - Intronic
921761145 1:218916581-218916603 CCTGGGTAACAGAATGAGGCAGG + Intergenic
923691470 1:236197744-236197766 CCTGGGTGACAGAGTGAGGCAGG - Intronic
923937103 1:238775019-238775041 ATTGGGTAACAGAGTAATGCTGG + Intergenic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1065466567 10:26030406-26030428 CATGGTCAAGAGAGTGTTGTGGG - Intronic
1066164451 10:32771802-32771824 CCTGGTTAGCAGAGTGGTGCAGG + Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1071922585 10:90368286-90368308 CTTGGGTATCAGAATGATGCTGG + Intergenic
1073573129 10:104597621-104597643 CATTGGAAACAGAGTGATCCTGG - Intergenic
1074768340 10:116716821-116716843 CATTGATAACAGAGTGACGGGGG - Intronic
1076375362 10:129980062-129980084 CTTGGGTAACAGAGTGAGACAGG + Intergenic
1078040488 11:7857800-7857822 GATGGCTAACAGAAAGATGCTGG + Intergenic
1078625550 11:12953690-12953712 TTTGGTTATCAGAGTAATGCTGG - Intergenic
1079201855 11:18383479-18383501 CATGGTTACCATGGAGATGCTGG + Intergenic
1079870282 11:25790103-25790125 CATGGTTCACAGAGTTATAAAGG - Intergenic
1080215872 11:29839791-29839813 CATGCTTTACAGAGTGATTTGGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1086754847 11:90547584-90547606 CATGGTACACTGAGTGGTGCTGG + Intergenic
1087036083 11:93758116-93758138 CCTGGTCAACATAGTGATGATGG + Intronic
1088340445 11:108759708-108759730 CATGGAAAAAAAAGTGATGCGGG - Intronic
1090223766 11:125055739-125055761 CCTGGTTCACACAGTGATGCTGG - Intergenic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1095796419 12:46224240-46224262 TATGGGTAACAAAGTGAGGCTGG - Intronic
1096927393 12:55164086-55164108 CTTTGGTAACAGAATGATGCTGG + Intergenic
1097508352 12:60504986-60505008 AATGGTTAAAAAAGTGATTCAGG + Intergenic
1101078156 12:101152632-101152654 CTTTGTTATCAGAATGATGCTGG - Intergenic
1101537447 12:105631786-105631808 CTTTGGTATCAGAGTGATGCTGG - Intergenic
1104220358 12:126776659-126776681 CATTTTTAAAATAGTGATGCAGG - Intergenic
1106947930 13:34849353-34849375 TGTTGGTAACAGAGTGATGCAGG + Intergenic
1107389481 13:39948518-39948540 TTTGGGTAACAGGGTGATGCTGG - Intergenic
1109659459 13:65439037-65439059 CTTTGCTATCAGAGTGATGCTGG - Intergenic
1110088576 13:71414445-71414467 CTTGGGTACCAGAGTAATGCTGG + Intergenic
1111846239 13:93512645-93512667 ATTGGTTATCAGGGTGATGCTGG + Intronic
1115198680 14:30829789-30829811 TATGTTTAACAGAGTGATCAAGG + Intergenic
1115956034 14:38780492-38780514 CTTTGGTATCAGAGTGATGCTGG - Intergenic
1115959194 14:38815925-38815947 CAAGGTGAACAGAGTCATGTAGG + Intergenic
1116628498 14:47298226-47298248 AATGGTTAAGAGCATGATGCTGG - Intronic
1117357865 14:54943418-54943440 CATGGGTGACAGAGTGAGACCGG - Intronic
1121329665 14:93041906-93041928 TATGGTTAACAGGGGGCTGCAGG - Intronic
1121506911 14:94484533-94484555 CATGGGCCACAGAGGGATGCTGG - Intergenic
1125223065 15:37362495-37362517 AGTGGGTATCAGAGTGATGCAGG + Intergenic
1128431819 15:67603231-67603253 CAACATTAACAGAGTGATGGGGG - Intronic
1129527742 15:76232306-76232328 CCTGGTAAACAGAATGAAGCAGG - Intronic
1130763466 15:86845570-86845592 CATTGTTAGCACAGTGATACTGG + Intronic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1136469840 16:30472848-30472870 CATGGCCATCACAGTGATGCAGG - Exonic
1137316182 16:47325979-47326001 CATTGTTATCAGGATGATGCTGG - Intronic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1138656591 16:58495112-58495134 CCTGCCTAACAGAGAGATGCTGG + Intronic
1138996573 16:62461032-62461054 TTTTGTTAACAGAGTGATTCTGG + Intergenic
1140978758 16:80085904-80085926 CCTGGTTAAGAGACTGATGTTGG + Intergenic
1140979026 16:80088556-80088578 CTTGGGTATCAGAATGATGCTGG + Intergenic
1142909654 17:3077607-3077629 CTTGGGTATCAGAGTGATGCTGG + Intergenic
1142924842 17:3226196-3226218 CTTGGGTATCAGAGTGATGCTGG - Intergenic
1143638792 17:8183283-8183305 CATGGTAAACAAATTGATGATGG - Intergenic
1149938210 17:60831200-60831222 CCTGGTTGACAGAATGAGGCTGG - Intronic
1150089564 17:62311068-62311090 GATGGATAACAGAGTGATTTGGG + Intergenic
1151695813 17:75716545-75716567 CCTGGGTAACAGAGTGAGACTGG + Intergenic
1155228053 18:23747364-23747386 CATGGGCAAAAGAGTGATGAGGG + Intronic
1155563606 18:27108165-27108187 CATGATTACAAGAGTCATGCAGG - Intronic
1159333865 18:67038081-67038103 CATTGTTAACATATTGATACCGG - Intergenic
1160746986 19:716476-716498 CATGGTCAACAGACTGGTGGTGG + Intronic
927280800 2:21304742-21304764 GATGGCGAACAGAGTGATGGAGG + Intergenic
930294247 2:49534430-49534452 CTTTGGTAACATAGTGATGCTGG - Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
933447180 2:82396491-82396513 CTTTGGTAACAGAGTAATGCTGG + Intergenic
937027156 2:118708844-118708866 CATCCTTAACACAGTGATACAGG + Intergenic
937165533 2:119812322-119812344 CTTGGTGAACAGAGAAATGCTGG - Intronic
940997059 2:160160852-160160874 CATGGGTAACTGAATTATGCAGG + Intronic
941858916 2:170258226-170258248 CATTGGTATCAGAATGATGCTGG - Intronic
942410291 2:175702523-175702545 CATTGGTATCAGAATGATGCTGG + Intergenic
942941551 2:181624556-181624578 CATGGAGAACAGACTGATGGGGG + Intronic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
945355536 2:208835224-208835246 CTTTGGTAACAGAATGATGCTGG - Intronic
946832290 2:223739157-223739179 GAAGGTTGAGAGAGTGATGCTGG + Intergenic
948796762 2:240407322-240407344 CATGGACAAGAGAGTGAAGCGGG - Intergenic
1168860154 20:1040278-1040300 CATTGCTATCAGAGTGATGGTGG - Intergenic
1171255714 20:23687891-23687913 CATGCTTAAGAGGGAGATGCAGG + Intronic
1171563687 20:26155793-26155815 CATTGGTATTAGAGTGATGCTGG + Intergenic
1171910793 20:30950419-30950441 CTTTGTTATCAGGGTGATGCTGG + Intergenic
1173459971 20:43235466-43235488 CGTGGCTAGCAGTGTGATGCTGG - Intergenic
1175042057 20:56062219-56062241 TTTTGTTAACAGAGTAATGCTGG - Intergenic
1178931847 21:36826066-36826088 CATAGTTCACAGAGTGAAGTTGG - Intronic
1182265648 22:29112997-29113019 CGTGGTGAACAGAGTGTTGAGGG + Intronic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184770081 22:46591885-46591907 CATGGCTAACTGAGGGGTGCGGG - Intronic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954929594 3:54269584-54269606 CATGCTTTACACAGTGATGGTGG - Intronic
957474201 3:80702995-80703017 CATTGGTATCAGAGTGATGCTGG + Intergenic
957968434 3:87352075-87352097 AATGATTAACAGAGTCATTCAGG + Intergenic
959084236 3:101834384-101834406 CCTGGGTAACAGAGTGAGACAGG - Intronic
959817183 3:110687792-110687814 CATGGTTAACAGAGTTATGGAGG + Intergenic
959941896 3:112089087-112089109 TATGGGTAATAGAGTGAGGCTGG + Intronic
964572528 3:158124404-158124426 CATTGGTATCAGAGTAATGCTGG + Intronic
965100806 3:164295042-164295064 CTTTGTTATCAGAATGATGCTGG - Intergenic
968011230 3:195278950-195278972 CATGCTTGACTGAGTGATCCTGG + Exonic
971942033 4:33227969-33227991 CATGGTTGACAAACTGAGGCAGG + Intergenic
975871750 4:78786655-78786677 CATTTTTAACAGAGTGGTGGAGG - Intronic
976698161 4:87940120-87940142 CAAGATTGACAGAGTCATGCAGG - Intergenic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
979864145 4:125732465-125732487 CATGGTTAGGACAGTGATGTTGG - Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
980875222 4:138655501-138655523 CATGGTAAACAGACTGGTACAGG + Intergenic
981917819 4:150053859-150053881 CCTGGGTAACAGAGTGATATTGG + Intergenic
983097094 4:163575537-163575559 GGTTGTTATCAGAGTGATGCTGG + Intronic
989000518 5:36755660-36755682 GATGGTTAAGATAGTGATGGTGG - Intergenic
990549948 5:56864817-56864839 CCGTGTTAACAAAGTGATGCGGG + Exonic
993009345 5:82462153-82462175 TTTGGATATCAGAGTGATGCTGG - Intergenic
993064497 5:83080690-83080712 CTTGGTTATCAGATTGATGGAGG + Intronic
993514282 5:88811155-88811177 GATGGTAAACAGACTGATGTAGG + Intronic
994221256 5:97197904-97197926 CATGGTTAGGAGAGTGTTGCTGG + Intergenic
994914133 5:105950860-105950882 CCTGCTTACCAGAGAGATGCAGG + Intergenic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
999739917 5:154542296-154542318 CAAGGTCAACTGTGTGATGCGGG - Intergenic
999779757 5:154839801-154839823 CAGGGATGACAGAGTGATGGAGG - Intronic
1001767639 5:174264178-174264200 CATTGGTAGCAGAGTAATGCTGG - Intergenic
1002010776 5:176278936-176278958 CTTTGTTATCAGAATGATGCTGG + Intronic
1003151613 6:3556471-3556493 CATGTTTCAAAGAATGATGCTGG + Intergenic
1005786895 6:29252831-29252853 CTTTGGTATCAGAGTGATGCTGG - Intergenic
1007043834 6:38751549-38751571 CCTGATTAGCTGAGTGATGCTGG - Intronic
1009655930 6:66544558-66544580 CATTGTTATCAGGATGATGCTGG - Intergenic
1010488421 6:76445118-76445140 CTTTGGTATCAGAGTGATGCTGG + Intergenic
1010757998 6:79690007-79690029 CATGGGTGACAGAGTGACGGAGG - Intronic
1011011560 6:82709624-82709646 CTTGGTTATCAGGGTAATGCGGG + Intergenic
1011179359 6:84602464-84602486 CTTTGTTATCAGAATGATGCTGG - Intergenic
1011395436 6:86901229-86901251 CTTTGTTATCAGAATGATGCTGG - Intergenic
1012168116 6:95983894-95983916 CATTGGTATCAGAATGATGCTGG - Intergenic
1013111936 6:107071078-107071100 CTTGGATGACAGAGTGATTCAGG - Intronic
1013382519 6:109590051-109590073 CTTTGGTATCAGAGTGATGCTGG + Intronic
1013762516 6:113534638-113534660 CTTTGGTAACAGAATGATGCTGG - Intergenic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1015815916 6:137210482-137210504 CATGTTTAATAGAGTGTTCCAGG - Intronic
1016826811 6:148395997-148396019 CATCATCAACAGAGTGCTGCTGG - Intronic
1017007176 6:150036439-150036461 CATGGTGAACACAGTGAGCCTGG - Intergenic
1017105266 6:150881609-150881631 AAAGGCTAACAGAGTGATGATGG - Intronic
1019930591 7:4220353-4220375 CATGGTCAACAAGGTGATGTTGG + Intronic
1021230262 7:18078615-18078637 CTTTGGTAACAGAGTAATGCTGG + Intergenic
1022558124 7:31320896-31320918 CATGATTGACAGAGAGATGAAGG + Intergenic
1022639655 7:32169963-32169985 CATGGGGAAAAGAGAGATGCAGG + Intronic
1025194786 7:56924353-56924375 CATGATTAATAGAGTGCTGAGGG - Intergenic
1025677166 7:63652590-63652612 CATGATTAATAGAGTGCTGAGGG + Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026055105 7:66976943-66976965 CCTGGCTAACACAGTGATGAGGG - Intergenic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1027976188 7:85159014-85159036 GATGGTAAAGAGAGTGATGTGGG - Intronic
1028526587 7:91793224-91793246 CATTGTTACCAGGATGATGCTGG - Intronic
1029100149 7:98122816-98122838 CATGTTTAAAAGTGTTATGCAGG - Intronic
1032856747 7:135841182-135841204 CATGGTTAGCAGGTTGATGTAGG - Intergenic
1034394514 7:150811213-150811235 CTTTGGTATCAGAGTGATGCTGG - Intergenic
1037445461 8:18961225-18961247 CATTGTTAATAAAGTGATGGTGG + Intronic
1037873011 8:22517349-22517371 CTTTGGTATCAGAGTGATGCTGG + Intronic
1038066354 8:23967577-23967599 CTTGGCTCACAGAGTGATGCGGG - Intergenic
1038514412 8:28173115-28173137 CTTTGATAACAGAGTAATGCTGG + Intronic
1043666154 8:82817038-82817060 CTTTGTTATCAGAGTAATGCTGG + Intergenic
1043801665 8:84618079-84618101 CTTTGGTATCAGAGTGATGCTGG + Intronic
1047844122 8:128787734-128787756 CTTGGTTATCAGAGTGCTGTGGG - Intergenic
1052175846 9:25462474-25462496 GATGTTTAAGAGAGTGAAGCTGG + Intergenic
1052780070 9:32772935-32772957 CTTTGTTATCAGAATGATGCTGG + Intergenic
1053827405 9:42039742-42039764 CATTGGTATCAGAATGATGCTGG - Intronic
1054603156 9:67147698-67147720 CATTGGTATCAGAATGATGCTGG + Intergenic
1057873615 9:98736259-98736281 GTTGGTTCACACAGTGATGCAGG - Exonic
1059082103 9:111261172-111261194 GATGTTTAATAGAGTTATGCTGG + Intergenic
1060057343 9:120426140-120426162 CATGGTTAACAGAGTGATGCAGG - Intronic
1185622353 X:1459165-1459187 GATGGATAACAGATTGATGATGG - Intergenic
1185622403 X:1460484-1460506 GATGGATAACAGATTGATGATGG - Intergenic
1188283014 X:28293385-28293407 CCTGGGTGACAGAGTGAGGCTGG + Intergenic
1188451352 X:30310451-30310473 CATGCTTAGCAAAGTAATGCAGG - Intergenic
1191180374 X:57556542-57556564 TTTTGGTAACAGAGTGATGCTGG - Intergenic
1191202668 X:57801504-57801526 CATGATTATCAGAGTGATACTGG - Intergenic
1192174112 X:68875194-68875216 CATTGTTAATAGAGTGGTACTGG + Intergenic
1193160361 X:78221778-78221800 CTTTGTTACCAGAATGATGCTGG + Intergenic
1193302153 X:79902534-79902556 CTTGGGTATCAGAATGATGCTGG - Intergenic
1193566760 X:83086182-83086204 CATTGGTATCAGAATGATGCTGG - Intergenic
1193627817 X:83841571-83841593 CTTGGGTATCAGAATGATGCTGG - Intergenic
1197498618 X:127217394-127217416 CTTTGTTATCAGAATGATGCTGG - Intergenic
1198643533 X:138781813-138781835 CTTTGGTATCAGAGTGATGCTGG - Intronic
1199713594 X:150490027-150490049 CATGGTGAGCATAGTAATGCAGG - Intronic