ID: 1060059264

View in Genome Browser
Species Human (GRCh38)
Location 9:120444462-120444484
Sequence TCTCCTACCCCCAGTGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060059262_1060059264 24 Left 1060059262 9:120444415-120444437 CCAGATGGGGAGTTCTCAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG No data
1060059260_1060059264 30 Left 1060059260 9:120444409-120444431 CCCACACCAGATGGGGAGTTCTC 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG No data
1060059261_1060059264 29 Left 1060059261 9:120444410-120444432 CCACACCAGATGGGGAGTTCTCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060059264 Original CRISPR TCTCCTACCCCCAGTGCATG AGG Intronic
No off target data available for this crispr