ID: 1060060365

View in Genome Browser
Species Human (GRCh38)
Location 9:120454256-120454278
Sequence CTGGATGTAGAAATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060060365_1060060374 5 Left 1060060365 9:120454256-120454278 CCTGGCCCCATTTCTACATCCAG 0: 1
1: 0
2: 2
3: 27
4: 226
Right 1060060374 9:120454284-120454306 AGTATGGCTTTAGATGAATCTGG No data
1060060365_1060060376 18 Left 1060060365 9:120454256-120454278 CCTGGCCCCATTTCTACATCCAG 0: 1
1: 0
2: 2
3: 27
4: 226
Right 1060060376 9:120454297-120454319 ATGAATCTGGCCAACCTGGCTGG No data
1060060365_1060060375 14 Left 1060060365 9:120454256-120454278 CCTGGCCCCATTTCTACATCCAG 0: 1
1: 0
2: 2
3: 27
4: 226
Right 1060060375 9:120454293-120454315 TTAGATGAATCTGGCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060060365 Original CRISPR CTGGATGTAGAAATGGGGCC AGG (reversed) Intronic
900748538 1:4378100-4378122 CTGGATGCAGCTCTGGGGCCAGG - Intergenic
901725867 1:11241607-11241629 CTGGCTCGAGCAATGGGGCCAGG - Exonic
902876296 1:19342774-19342796 CTGGATGTAGATCTGGCGCTGGG + Exonic
903085722 1:20856865-20856887 ATAGAAGTAGAAATGAGGCCGGG + Intronic
903955749 1:27024261-27024283 CTATATGGAGAAATGGGGGCCGG - Intergenic
905007231 1:34719627-34719649 CTGGAGGTGCAAATGGGGCATGG - Intronic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
906831268 1:49034200-49034222 CAAGATGGAGAAATGGGGACAGG + Intronic
907915016 1:58860687-58860709 CTGGAAGTAGAACTGGGGGCGGG - Intergenic
911089710 1:94008872-94008894 CTAGATGAAGAAAAGGGGTCAGG + Intronic
912615794 1:111098448-111098470 CAGGGTGAAGAAATGGTGCCAGG + Intergenic
912855713 1:113167205-113167227 CTGGATCTAGAAATCAGGCATGG + Intergenic
912887258 1:113488436-113488458 CTGCAAGCAGGAATGGGGCCTGG - Intronic
913999738 1:143683290-143683312 GGGGATGTAGAAATGGGAACAGG + Intergenic
914194926 1:145442222-145442244 GGGGATGTAGAAATGGGGACAGG + Intergenic
914476200 1:148024789-148024811 GGGGATGTAGAAATGGGGACAGG + Intergenic
915308712 1:154996134-154996156 CTGGAGGTGGGAATGGGGGCAGG + Intergenic
915475815 1:156152274-156152296 CTGGAGGAAGAACTGGGGGCAGG + Intronic
915916995 1:159946114-159946136 GTGGAGGTAGAAATGGGGATGGG - Intergenic
916516714 1:165525256-165525278 CAGGATGCAGAAATGGGACCTGG - Intergenic
917680404 1:177360398-177360420 CTGGATGTAAAGATGTGGCTTGG + Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
921481660 1:215671165-215671187 CTGGAGGTACAAATGGCTCCAGG - Exonic
922335290 1:224614376-224614398 CTGGAGGGAGATATGAGGCCAGG + Intronic
922643249 1:227257873-227257895 CTAGAACTAAAAATGGGGCCGGG + Intronic
923824353 1:237483404-237483426 ATGGATGTAATAATGGTGCCTGG - Intronic
924813151 1:247420908-247420930 CTGGATGGAGAATTGGAGGCAGG - Intronic
1063221447 10:3972250-3972272 CTTCATGTAGAAAATGGGCCTGG + Intergenic
1063877852 10:10498529-10498551 CTGGTTAGAGAAATGGGACCAGG + Intergenic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1067203964 10:44198017-44198039 CAGGATGCAGCAATGGGGCTAGG + Intergenic
1067258616 10:44666716-44666738 CAGGAAGTAGCAGTGGGGCCAGG - Intergenic
1068673961 10:59750877-59750899 CAGGATGCAGAAATGGGACTAGG + Intergenic
1070396233 10:76013324-76013346 CTGGATGTAGAAAAGAGGAAGGG + Intronic
1070551083 10:77491301-77491323 CTGGATCTGGAACTGGGGCCTGG + Intronic
1070600773 10:77864886-77864908 CTGGCTGGAGATCTGGGGCCTGG - Intronic
1070759388 10:79014292-79014314 TTGGATGTAGAAATTGGGAAAGG - Intergenic
1071886479 10:89956356-89956378 TGGGATGTGGAAATGGGCCCAGG + Intergenic
1072625012 10:97105719-97105741 CTTGAGGTGAAAATGGGGCCAGG + Intronic
1072758367 10:98036053-98036075 CTGGAGGCAGAAGTGAGGCCAGG - Intergenic
1073298094 10:102453232-102453254 GTGGATGGAAAAAAGGGGCCTGG + Intergenic
1073796664 10:106995931-106995953 AAGAATGTAGAAATGAGGCCAGG + Intronic
1075583052 10:123636665-123636687 CTGGATGGGGAGATGAGGCCGGG + Intergenic
1077298664 11:1837546-1837568 GGGGATGCAGAAATAGGGCCCGG + Intergenic
1077310110 11:1884623-1884645 TTGGATGAAGGAATGGTGCCAGG - Intronic
1078005406 11:7528885-7528907 CTGGATGGAGAACTGGGCCCTGG - Intronic
1078094295 11:8287132-8287154 CTGGATGAAGTGATGGGTCCAGG - Intergenic
1079833480 11:25300994-25301016 CTAGATGTACAATTTGGGCCTGG + Intergenic
1080579713 11:33632265-33632287 CAGGATGTAGATATGAGGCCTGG - Intronic
1080858631 11:36133830-36133852 TTCGATGTAGAAAATGGGCCGGG - Intronic
1084655727 11:70516771-70516793 CTGAATATAAAAATGGGGCTGGG + Intronic
1084784954 11:71436989-71437011 CCAGGTGGAGAAATGGGGCCGGG + Intronic
1085251059 11:75144375-75144397 CTGGAGGTAGGAAAGAGGCCGGG + Intronic
1085835481 11:79951360-79951382 CTTGATGTAGAAAGGGGGCAGGG - Intergenic
1088611205 11:111578835-111578857 CTTGAAATATAAATGGGGCCAGG + Intergenic
1089181830 11:116588544-116588566 TTAGAAGTAGAAATGGGGGCTGG + Intergenic
1090258444 11:125302259-125302281 CTGGACCTAGAAGTTGGGCCTGG + Intronic
1090878223 11:130810394-130810416 TTGAAAGCAGAAATGGGGCCAGG + Intergenic
1091057543 11:132432982-132433004 GTGGATGCAGAATTGGGGACTGG + Intronic
1091857520 12:3751654-3751676 CTGGATGTGGCACTGAGGCCGGG - Intronic
1092836397 12:12493114-12493136 ATGGATGTATGAATGGGGCAGGG - Intronic
1096104582 12:48989467-48989489 ATGGAAGTATAAATGGGGCCAGG + Intergenic
1096181558 12:49553949-49553971 CTGTAGGTAGAGATAGGGCCTGG + Intronic
1101119097 12:101560703-101560725 CTGGATGAAGAAAATGGGCCGGG - Intergenic
1101381391 12:104216391-104216413 GGGGATGGAGAAAGGGGGCCGGG - Intronic
1101919509 12:108920890-108920912 ATGGATGTAAAAATGGGGCCGGG - Intronic
1102021012 12:109683018-109683040 CTGGATGATCAATTGGGGCCAGG - Intergenic
1104245399 12:127035384-127035406 CTGGTTGTAGAACTGGGGTAAGG + Intergenic
1106406524 13:29479639-29479661 CTGGAGATAGGAATAGGGCCTGG - Intronic
1111524340 13:89448900-89448922 CTCGATGTAGAAACAGGGGCTGG - Intergenic
1112521665 13:100101096-100101118 CTAGAAGTAGAACTCGGGCCGGG - Intronic
1112900429 13:104351505-104351527 CAGCAAGTAGAAATGGGGCCAGG - Intergenic
1113714349 13:112492703-112492725 CTGGCTATGGGAATGGGGCCTGG + Intronic
1113714585 13:112493879-112493901 CTGGCTATAGGAATGGGGCCTGG + Intronic
1116485741 14:45445934-45445956 CTAGATTTATAAATGGAGCCAGG - Intergenic
1116687666 14:48061846-48061868 CTGGATGTAGAAATCTGGGTTGG - Intergenic
1118717519 14:68570664-68570686 CTGGAGGTAAAAATGGGGATGGG - Intronic
1120883989 14:89437373-89437395 TTGGAGGTAGAAATGGGCCCAGG - Intronic
1121879883 14:97490459-97490481 TTGGAATTAGAAATGGAGCCCGG + Intergenic
1123881278 15:24678946-24678968 CCTGATGTGGAACTGGGGCCTGG - Exonic
1125724810 15:41862759-41862781 CTGGCTGTAGAGCTGGGCCCAGG - Intronic
1127384697 15:58457857-58457879 CAGGATGGAGACATGGGCCCGGG - Intronic
1129520649 15:76183940-76183962 CTGGATGGGGAGATGGGCCCTGG - Intronic
1130433112 15:83868968-83868990 CGGGATGCAGAATTGGGGCAAGG - Intronic
1130849619 15:87780374-87780396 CTCGAGGCAGAAATGGGGGCAGG - Intergenic
1130890719 15:88131761-88131783 CTGGATGTATAAATGCTTCCAGG - Intronic
1130927609 15:88397136-88397158 CTGAATGAAGAAATGGCGGCTGG + Intergenic
1132157814 15:99508915-99508937 CTGGATGCAGTGATGGGCCCAGG + Intergenic
1132692543 16:1188105-1188127 GTGGAGGTAGAATTGGGGTCAGG + Intronic
1133001698 16:2855050-2855072 TTTGAAGTAGAAATGAGGCCAGG + Intronic
1133219197 16:4311661-4311683 CTAGAAGGAGAAATGGGGCCTGG + Intergenic
1134894784 16:17875429-17875451 ATTGTTGTAGAAATGGGGTCTGG - Intergenic
1136025229 16:27464449-27464471 CTGGGGGTGGAGATGGGGCCTGG + Exonic
1136032598 16:27514450-27514472 CTGCTTGTAGAAAGGGAGCCTGG - Intronic
1138516478 16:57538025-57538047 TTGGAGGTGGAAATGGGGCTGGG + Intergenic
1139596853 16:67963248-67963270 CTGGAGGTAGCAATGGGGGTGGG + Intronic
1141248437 16:82332592-82332614 CTGGAAGGTGAAATGGGGACAGG - Intergenic
1143399694 17:6636347-6636369 AAGGCTGCAGAAATGGGGCCCGG + Intronic
1144840519 17:18183167-18183189 CTGGGTTCAGAACTGGGGCCGGG + Intronic
1146912111 17:36655495-36655517 CTGGATGTGGAAATGGGTGTGGG - Intergenic
1147207796 17:38850902-38850924 TGGGATGTAGAAATGGGACCTGG + Intronic
1147587348 17:41660107-41660129 CTGGTGGGAGGAATGGGGCCAGG - Intergenic
1147896289 17:43753537-43753559 CTGGGTGAAGAAATGCGGTCTGG + Intergenic
1147953828 17:44121653-44121675 GTGTGTTTAGAAATGGGGCCTGG - Intronic
1148465387 17:47861866-47861888 CTTTTTGTAGAAATGGGGTCTGG - Intergenic
1150299661 17:64037629-64037651 CTGGATGTACTTCTGGGGCCTGG - Intergenic
1151109520 17:71659077-71659099 GTGGATGTAAAACTGGGGCTGGG + Intergenic
1152281110 17:79385305-79385327 CTGGTAGTGGACATGGGGCCTGG - Intronic
1153007085 18:506513-506535 GTGGGTTTAGAAATGGAGCCTGG + Intergenic
1153757608 18:8299928-8299950 CTGGTGGTAGAAATGTGCCCTGG - Intronic
1158803302 18:60939586-60939608 ATACATGTACAAATGGGGCCGGG + Intergenic
1161257224 19:3316121-3316143 CCGTATGGAGAAATGGGGCCTGG - Intergenic
1162997547 19:14345831-14345853 CTGGCTGTAAAATTGGGGCAGGG + Intergenic
1163233964 19:16020464-16020486 CTGGATGGAGACCTGGGGCGGGG + Intergenic
1163307063 19:16487181-16487203 ATTGTTGTAGAGATGGGGCCAGG + Intronic
1164619033 19:29682806-29682828 CTGGCTCTAGAAATGGGCACAGG + Intergenic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1165449470 19:35873836-35873858 CTGCATGTAGGCATGGGGCCAGG - Intronic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
1168426118 19:56240415-56240437 CAGGAACTGGAAATGGGGCCTGG + Exonic
925904732 2:8533723-8533745 CTGGATTTAAACCTGGGGCCTGG - Intergenic
926308524 2:11657734-11657756 CTGGCGGTAGAAAGTGGGCCTGG + Intergenic
927712525 2:25334493-25334515 CTGGAGGTATAACTGGGGCCCGG - Intronic
927867210 2:26597799-26597821 ACGGATGTGGAAATGAGGCCTGG + Intronic
928519898 2:32078469-32078491 ATTGTTGTAGAAATGGGGCCGGG - Intronic
928639176 2:33279795-33279817 CTAGTTGAAGAATTGGGGCCAGG + Intronic
929032096 2:37658691-37658713 CTTGATGTAGAGATGGAGGCGGG - Intronic
929573790 2:43039797-43039819 CTGGTAGGAGAACTGGGGCCGGG - Intergenic
929831612 2:45351303-45351325 TTGCCTGTAGAACTGGGGCCAGG + Intergenic
929866949 2:45726016-45726038 CTAGAATTAGAAATGGAGCCTGG + Intronic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
935482115 2:103603232-103603254 CTGGGTCAAGAAATGGAGCCAGG + Intergenic
937312579 2:120911114-120911136 CAGGAAGAAGAAATGAGGCCGGG - Intronic
938491548 2:131763795-131763817 CCTGATGTACATATGGGGCCTGG - Intronic
938496019 2:131798547-131798569 CCTGATGTACATATGGGGCCTGG + Intronic
938556250 2:132426893-132426915 CGGCATGCAGAAATGGGGGCAGG + Intronic
939065585 2:137479688-137479710 CAGCATCTAGAAATGGTGCCTGG + Intronic
940882782 2:158963013-158963035 CTGGGGGTAGAAAAGGGGCATGG + Intergenic
944252116 2:197588926-197588948 ATGGTTTTAAAAATGGGGCCAGG + Intronic
944694342 2:202187600-202187622 TAGGAATTAGAAATGGGGCCAGG - Intronic
946172537 2:217904100-217904122 GGAGATGTAGGAATGGGGCCGGG - Intronic
947153086 2:227134208-227134230 CTGAATGTAGTAATGGGGAGAGG - Intronic
1169343059 20:4810712-4810734 CTGGTTGTAGAGCAGGGGCCAGG + Intronic
1171251789 20:23654438-23654460 CTGTGTGGAGATATGGGGCCAGG + Intergenic
1171307380 20:24117939-24117961 CTGGGAGGAGGAATGGGGCCAGG - Intergenic
1171449319 20:25224929-25224951 TTAGATGTAGAAATGTGGCTTGG + Intronic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1175605858 20:60311728-60311750 ATGGATGCAGCAAAGGGGCCTGG + Intergenic
1176066396 20:63198772-63198794 CTGGAGGTCGAAGTGGGGTCAGG + Intronic
1176282631 20:64322980-64323002 CTGGTCTAAGAAATGGGGCCAGG - Intergenic
1178039722 21:28626664-28626686 GTTTATGTAGAGATGGGGCCTGG - Intergenic
1178739568 21:35185661-35185683 TTGTATTTAGAAATGGGGACGGG + Intronic
1179946707 21:44683028-44683050 CTGGATGTCGACGTGGGGACTGG - Intronic
1180056617 21:45362259-45362281 CTGGATGCAGGTAGGGGGCCTGG - Intergenic
1180902553 22:19385341-19385363 CATGATGCAGTAATGGGGCCTGG - Intronic
1181959166 22:26610607-26610629 CAGGAGGTAGAAATGGTCCCGGG + Intronic
949463280 3:4317385-4317407 AAGAATGTAGAAATGTGGCCTGG + Exonic
949894121 3:8756787-8756809 CCGGATGAAGGCATGGGGCCTGG - Intronic
951449944 3:22826003-22826025 CTGAATTTAGTAATGGCGCCTGG + Intergenic
952594510 3:34999964-34999986 CTTGCTGTAGTCATGGGGCCAGG + Intergenic
952727841 3:36607016-36607038 GTGGGTGTACAAATGTGGCCAGG + Intergenic
954677333 3:52323180-52323202 CAGGATGTAAGAGTGGGGCCTGG + Intronic
960133313 3:114080621-114080643 CTGGAGGTAGAAAAGGAGCTAGG + Intronic
960502787 3:118457220-118457242 CTGGTGTTAGAAATGAGGCCTGG - Intergenic
960585510 3:119317470-119317492 CTGAAAATAGAAATGTGGCCAGG - Intronic
961861214 3:129918054-129918076 CTGAAGGTAGGACTGGGGCCAGG - Intergenic
966578968 3:181537660-181537682 CTTGAGGTACAAATAGGGCCAGG - Intergenic
966736291 3:183189621-183189643 CTGGAAGGAGAAATGGGTCCTGG + Intronic
967143235 3:186582017-186582039 CTGGAAGTAGAAATAGAGCCTGG + Exonic
968726908 4:2252042-2252064 CTGGAAGGAGAGAGGGGGCCAGG - Intronic
968800745 4:2742031-2742053 CTGGAGGTGGAGATGGGGTCAGG - Exonic
968926142 4:3549463-3549485 ACAGATGAAGAAATGGGGCCTGG + Intergenic
970435177 4:16026626-16026648 CAGGATGGAGAAATGGGACATGG - Intronic
972011496 4:34189103-34189125 CTCAATGTTGAAGTGGGGCCTGG + Intergenic
972319496 4:37960169-37960191 ATGGATGTGGAAATAGGGCTTGG + Intronic
972633234 4:40859798-40859820 CTGGAAGAAGAAAAGGGGACTGG - Intronic
973759024 4:54100424-54100446 CGGGATGAAGAAATCCGGCCCGG - Exonic
975280894 4:72561050-72561072 TTAGATTAAGAAATGGGGCCAGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977225940 4:94391807-94391829 GAGGATATAGAAATGGGGACTGG + Intergenic
977298549 4:95239520-95239542 CTGGATATGGACATGGGTCCCGG - Intronic
977812675 4:101375647-101375669 ATTTATGTAGAAATGTGGCCAGG + Intergenic
978722693 4:111930785-111930807 CTTGTTGCAGAAATGAGGCCTGG + Intergenic
979343996 4:119563796-119563818 CTGTTTGTAAAAATGGGGACTGG + Intronic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
983639280 4:169929611-169929633 CTGAATCTAGAAATAGGCCCAGG - Intergenic
983719274 4:170826984-170827006 TTTTTTGTAGAAATGGGGCCTGG - Intergenic
984554023 4:181192668-181192690 CTAAATGCAGAAATAGGGCCAGG - Intergenic
987582307 5:19810032-19810054 CTAGATGTCAAAATGAGGCCTGG + Intronic
990080729 5:51910577-51910599 CAGTATGTAGACATAGGGCCTGG + Intergenic
991340160 5:65600201-65600223 CCCAATGTTGAAATGGGGCCTGG - Intronic
992019896 5:72612195-72612217 CTGGACGTAGAAAAGGTGCTGGG - Intergenic
995476651 5:112554805-112554827 GTGGGTGTGGAAGTGGGGCCGGG + Intergenic
995884657 5:116880464-116880486 AAGGATGAAGAAATGGGGCCAGG + Intergenic
995948848 5:117684896-117684918 ATGCTTGTAGAAATGGGGCTGGG + Intergenic
996375706 5:122804658-122804680 ATGGAAGTACAAATGTGGCCGGG - Intronic
996653772 5:125914675-125914697 CAGGATGTGGAAAAGGGGTCAGG + Intergenic
996777935 5:127153121-127153143 CTTGATTTAAAAATGGGGCTGGG - Intergenic
999147956 5:149408114-149408136 CGGGATGAAGCAGTGGGGCCAGG + Intergenic
1000344829 5:160305976-160305998 CTGGTTTAAGAAATGTGGCCGGG + Intronic
1001249504 5:170135969-170135991 CTGGATGAAGAAATGGGGCTTGG + Intergenic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1002655450 5:180743098-180743120 ATGGATGAGGAAATGGGGCAGGG - Intergenic
1007358023 6:41335109-41335131 CAGGATGCAGAGATGAGGCCAGG + Intergenic
1008274683 6:49529125-49529147 CAAGAAGTAGAAACGGGGCCAGG + Intergenic
1009957867 6:70477703-70477725 CTCAATGTTGGAATGGGGCCTGG - Intronic
1011047425 6:83100764-83100786 CTGGATGTAGACATTGAGCTAGG - Exonic
1012782843 6:103584947-103584969 CTAGAAGTAGAAGTGGAGCCTGG - Intergenic
1014867639 6:126551296-126551318 CAGGAGGAAGAAATGTGGCCAGG - Intergenic
1016947555 6:149548389-149548411 CTTGTTGTAGAAATGGGCCATGG + Intergenic
1018763451 6:166910269-166910291 CTGGATCAAGAAATGGGCCCTGG - Intronic
1020959119 7:14780034-14780056 TAAGATGTAGAAATGGGGCATGG + Intronic
1025251394 7:57353664-57353686 CTGGATGTGGAATTGAGCCCGGG + Intergenic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1028798977 7:94939181-94939203 CTAGATGAAGAAATGAGGCTGGG - Intronic
1031598024 7:123670092-123670114 CTGGATGGAGGAGTGGGGGCTGG + Intergenic
1032649075 7:133857938-133857960 CGGGAAGCAGCAATGGGGCCAGG - Intronic
1034412039 7:150946929-150946951 GGGGATGTGGAAGTGGGGCCAGG + Exonic
1036751345 8:11445350-11445372 CTGGATGTAGAAACGGCTGCTGG - Intronic
1036789082 8:11705635-11705657 CTGGTTGTTGAAATTGAGCCTGG - Intronic
1037651565 8:20843611-20843633 CTGGAGGCAGAAAATGGGCCAGG + Intergenic
1038239888 8:25798630-25798652 CTGCATGTAGAAGCGGGGGCAGG + Intergenic
1038671943 8:29589791-29589813 CTGGTGGTAGAAATGGGAACAGG + Intergenic
1042960681 8:74300934-74300956 CTGGTTGGGGAAATGGGGCGGGG - Intronic
1043606650 8:82008662-82008684 GAAGATGGAGAAATGGGGCCAGG + Intergenic
1044259460 8:90100631-90100653 CTAGAATTAGAAATGGAGCCTGG - Intergenic
1047714471 8:127582917-127582939 CTGGATTTGGAAATGTAGCCTGG - Intergenic
1048882976 8:138885427-138885449 CTTGATGTAGAATGGGGGTCTGG - Intronic
1049200724 8:141339397-141339419 CTGGATTTAAAAAAGAGGCCAGG - Intergenic
1050180210 9:2914396-2914418 CTAGATGGAGAAATGTGGGCTGG + Intergenic
1053801074 9:41764869-41764891 ACAGATGAAGAAATGGGGCCTGG + Intergenic
1054144127 9:61549968-61549990 ACAGATGAAGAAATGGGGCCTGG - Intergenic
1054189505 9:61977019-61977041 ACAGATGAAGAAATGGGGCCTGG + Intergenic
1054463897 9:65481297-65481319 ACAGATGAAGAAATGGGGCCTGG - Intergenic
1054649011 9:67611590-67611612 ACAGATGAAGAAATGGGGCCTGG - Intergenic
1055060837 9:72067101-72067123 CTGGATGTAGAATTCGGGCTTGG - Intronic
1055487314 9:76768486-76768508 ATAGTTGTTGAAATGGGGCCAGG - Intronic
1057958474 9:99432050-99432072 CTGTATGTGGAAAATGGGCCAGG - Intergenic
1058829460 9:108802357-108802379 CTGGATGGAGCCATGGGTCCAGG - Intergenic
1059389844 9:113992207-113992229 CTGGATGTAGAAGTGGGCAGTGG + Intronic
1060060365 9:120454256-120454278 CTGGATGTAGAAATGGGGCCAGG - Intronic
1060965053 9:127707545-127707567 CAGGAAGTGGAAGTGGGGCCTGG - Intronic
1203785615 EBV:125973-125995 CTGGATGGAGATATTGGGCAGGG - Intergenic
1185791658 X:2932008-2932030 CAGGATTTGGAAATGGGGCCTGG + Intergenic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1186028134 X:5336665-5336687 CTGAATGTAGGAATGAGGCAGGG + Intergenic
1186212325 X:7262408-7262430 CAGGGTGGAGACATGGGGCCTGG - Intronic
1188406555 X:29817881-29817903 CTGGATATAGATATGATGCCTGG - Intronic
1189417949 X:40831615-40831637 CTGGAGGTGGAGATGGGGTCAGG - Intergenic
1190010286 X:46778821-46778843 ATGAATTTAGAAATGTGGCCAGG + Intergenic
1195239940 X:102940942-102940964 GTGGATGTAGAGAGGGGTCCAGG - Intergenic
1195275961 X:103281021-103281043 CTGGACATAGAAATGGGCACAGG - Intergenic
1198682691 X:139199722-139199744 ATGGATGTTGAATTGGGGCCTGG - Intronic
1201149846 Y:11089711-11089733 CCTGATGTACACATGGGGCCTGG + Intergenic
1201281985 Y:12350264-12350286 CAGGATTTGGAAATGGGGCCTGG - Intergenic
1202102986 Y:21330001-21330023 CTGGATGCAGCAATGTGGCTGGG + Intergenic