ID: 1060060727

View in Genome Browser
Species Human (GRCh38)
Location 9:120457149-120457171
Sequence ATGAAGAAATGGGCTCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060060718_1060060727 27 Left 1060060718 9:120457099-120457121 CCTCACAATAAGACTGTGAGAGG 0: 1
1: 0
2: 2
3: 29
4: 534
Right 1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060060727 Original CRISPR ATGAAGAAATGGGCTCATAA AGG Intronic
No off target data available for this crispr