ID: 1060061690

View in Genome Browser
Species Human (GRCh38)
Location 9:120466363-120466385
Sequence CATCATCCCCCAGAATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060061690_1060061698 13 Left 1060061690 9:120466363-120466385 CCATCCCATTCTGGGGGATGATG 0: 1
1: 0
2: 3
3: 16
4: 144
Right 1060061698 9:120466399-120466421 TGAAGAACAAGGCTATTCATGGG No data
1060061690_1060061697 12 Left 1060061690 9:120466363-120466385 CCATCCCATTCTGGGGGATGATG 0: 1
1: 0
2: 3
3: 16
4: 144
Right 1060061697 9:120466398-120466420 ATGAAGAACAAGGCTATTCATGG No data
1060061690_1060061696 2 Left 1060061690 9:120466363-120466385 CCATCCCATTCTGGGGGATGATG 0: 1
1: 0
2: 3
3: 16
4: 144
Right 1060061696 9:120466388-120466410 GAGCTGTGCTATGAAGAACAAGG No data
1060061690_1060061699 14 Left 1060061690 9:120466363-120466385 CCATCCCATTCTGGGGGATGATG 0: 1
1: 0
2: 3
3: 16
4: 144
Right 1060061699 9:120466400-120466422 GAAGAACAAGGCTATTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060061690 Original CRISPR CATCATCCCCCAGAATGGGA TGG (reversed) Intronic
902282470 1:15384473-15384495 CACCAAACCACAGAATGGGACGG + Intronic
902734836 1:18393416-18393438 AATCAGTCCCCAGAATGAGAAGG - Intergenic
911028630 1:93461999-93462021 CATCACCTGCCAGAATGGAAGGG + Intronic
914204550 1:145516046-145516068 CATCACCCTCCAGCTTGGGAGGG - Intergenic
914483674 1:148089234-148089256 CATCACCCTCCAGCTTGGGAGGG - Intergenic
914783349 1:150805922-150805944 CTTTATATCCCAGAATGGGAAGG - Exonic
915268972 1:154739005-154739027 TTTCATCTCCCAGAGTGGGAAGG + Intronic
916694684 1:167222148-167222170 CCTCCTGCCCCAGAATGGGCTGG + Intronic
922799546 1:228358938-228358960 CTCCATCTCCCAAAATGGGATGG - Intronic
1064215903 10:13400470-13400492 CCTCATCCCCTAGCATGAGATGG - Intergenic
1065319843 10:24499137-24499159 CATCATTCCCCAGACAGAGAGGG - Intronic
1065495210 10:26320592-26320614 AATCATCACAGAGAATGGGATGG + Intergenic
1067936324 10:50615263-50615285 CTTTATGCCCCAGAATTGGATGG - Intronic
1068438064 10:57016865-57016887 AATGACCCCCCAGAATGGGATGG + Intergenic
1070551488 10:77494034-77494056 CATCAGCCCCCAGAAAGCAAAGG - Intronic
1071428287 10:85581635-85581657 CATCACTCCCAAGAATGTGAAGG - Intergenic
1076329866 10:129656321-129656343 CTTCAGCCCCGAGCATGGGAGGG + Intronic
1079360565 11:19767015-19767037 CCTGATGCCCCAGGATGGGATGG + Intronic
1080868785 11:36218286-36218308 CATCAACCCCCAGAAGGGCATGG - Intronic
1081716698 11:45255660-45255682 CATCCTCCCTCAGAATGGTAGGG - Exonic
1082867722 11:57914861-57914883 CACCATCCCTCAGAATGTGATGG - Intergenic
1084383903 11:68830160-68830182 CCTCAGCCCCCAGAATGGCTAGG - Intronic
1089983350 11:122790376-122790398 CATGAGCCTCCAGAATTGGATGG + Intronic
1090373253 11:126271424-126271446 CTACATCCCACAGACTGGGATGG + Exonic
1090668015 11:128927736-128927758 CAGCATCCCCCAGAATCACAGGG - Intergenic
1101762764 12:107672583-107672605 CATCATTCTCCAGAATGGAATGG - Intergenic
1103701781 12:122851847-122851869 CATCAGCCCCAAGACAGGGAGGG + Intronic
1104660766 12:130610126-130610148 CATTTTCCCCCAGAACGGGAGGG - Intronic
1104660781 12:130610169-130610191 CATTTTCCCCCAGAACGGGAGGG - Intronic
1104660795 12:130610212-130610234 CATTTTCCCCCAGAACGGGAGGG - Intronic
1105581922 13:21706167-21706189 CAACATCCCACAAAATGGTAAGG - Intergenic
1106724552 13:32470696-32470718 AACAAGCCCCCAGAATGGGATGG + Intronic
1112427601 13:99317632-99317654 CATCATTGCCAAGCATGGGATGG + Intronic
1117102980 14:52369424-52369446 CACCAGCCACTAGAATGGGAAGG - Intergenic
1119163931 14:72476692-72476714 CATCCACCCACAGAATTGGAGGG - Intronic
1121475665 14:94199731-94199753 CATCAACCCCCGGAATGAGGTGG - Intronic
1122391293 14:101387353-101387375 CATCATCCTCCTGAATAGGTGGG + Intergenic
1123940517 15:25214434-25214456 CACCATGCCCCTGAATGGGATGG + Intergenic
1126679104 15:51186915-51186937 CATCTTCCCCCATAAAGGCAAGG - Intergenic
1128317696 15:66671392-66671414 CATCTTCCCCCAGAATTGCTTGG + Intronic
1128584383 15:68834950-68834972 CCCCATTACCCAGAATGGGATGG + Intronic
1129385477 15:75193916-75193938 CACCATCTCTCACAATGGGAAGG + Intergenic
1133612630 16:7447884-7447906 CATCAACCCCCTGGAGGGGAGGG + Intronic
1135803734 16:25523228-25523250 AAACATTCCCCACAATGGGAAGG - Intergenic
1136934135 16:34443282-34443304 CAAAATCCTCCACAATGGGAGGG + Intergenic
1136970437 16:34968532-34968554 CAAAATCCTCCACAATGGGAGGG - Intergenic
1137726744 16:50661883-50661905 CATCATGCCCCAGAAGATGAAGG - Intergenic
1138496416 16:57411871-57411893 CAACATCCCAGAGAAAGGGAGGG - Intronic
1138658006 16:58501711-58501733 GCTCATCTCCCAGGATGGGAAGG - Intronic
1139937900 16:70584379-70584401 CCACATCCCCCAGTATGGAAAGG - Intronic
1140032990 16:71353370-71353392 CATCATATCCCAGAATGCAAAGG - Intergenic
1142214576 16:88824346-88824368 CAGCAACCCCCAGTGTGGGAGGG - Intronic
1144837969 17:18167469-18167491 CATCCTACCCCAGAAGAGGATGG + Intronic
1144846313 17:18221467-18221489 CACCATCTCCCAGGCTGGGAGGG - Intergenic
1146543821 17:33720845-33720867 CATCATACTGCAGAAAGGGAAGG + Intronic
1147972636 17:44227798-44227820 CATCTTCCCCCTGGCTGGGAGGG + Intergenic
1148085280 17:44990207-44990229 CCTCAGCCCCCTGAGTGGGATGG + Intergenic
1148615409 17:48997102-48997124 CATCCTCCCCCAGTTTGGGCTGG + Intergenic
1150483436 17:65528094-65528116 GATCAGCTCCCAGAATGGGGAGG + Intergenic
1152606554 17:81294524-81294546 AATGATCCTCCAGAATCGGAAGG - Intronic
1156313371 18:35945552-35945574 CATCATCGCCCAACATGGGGTGG - Intergenic
1159007577 18:63026143-63026165 CATCATCCCCAAGAAGAGCAAGG + Intergenic
1161138803 19:2636203-2636225 CATCCACCCCCTGAGTGGGAGGG - Intronic
1161698422 19:5782869-5782891 CATCATCCCGCGGACTGGCAAGG - Intergenic
1162011147 19:7815879-7815901 CAACATCCCACAGAAGGGGTGGG + Intergenic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1165976364 19:39680251-39680273 CCTCTTCTCCCACAATGGGATGG - Intergenic
1165999031 19:39866766-39866788 CATCTTCTTCCAGGATGGGATGG - Exonic
1168666639 19:58209670-58209692 CAGCAGCCCCCGGAAAGGGAAGG + Intronic
925440609 2:3882332-3882354 CATCATCCTCATGAATAGGAAGG + Intergenic
925784678 2:7420298-7420320 CATGATCTCCCAGAATAGCAGGG - Intergenic
925927764 2:8682318-8682340 CAGCATCCCCCAGAACAAGAAGG + Exonic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
930054902 2:47244378-47244400 CTTCATCCTCCTGGATGGGATGG - Intergenic
930648344 2:53936765-53936787 CAAAATCTCCCACAATGGGAGGG - Exonic
936402696 2:112177301-112177323 AATCTTCCCCAGGAATGGGAAGG + Intronic
936479099 2:112868670-112868692 CATCATCTTCCAGCATGGGTGGG - Intergenic
936526844 2:113247117-113247139 GCTCATCCCCCACGATGGGATGG + Intronic
937259104 2:120574103-120574125 CATCATCCCCCAGAAAGCCCAGG - Intergenic
938068312 2:128293494-128293516 CCTCATACCCCAGGACGGGAGGG + Intronic
938095874 2:128463019-128463041 CATGATCCCACAGACTGGGGTGG + Intergenic
940906981 2:159178681-159178703 CAACATCTCCCTGAATGGCAAGG + Exonic
943661172 2:190561106-190561128 CATCAAGCCCCAGCATGGGAAGG - Intergenic
946070565 2:217031012-217031034 CATCTTCTCCTAGAATGAGAAGG + Intergenic
948239647 2:236419401-236419423 CACCATGCCCCAGAAGGGGTCGG - Intronic
948808412 2:240462826-240462848 CATCATGGGCCAGGATGGGAAGG + Intronic
948893194 2:240916794-240916816 CTCAATCCCCCAGACTGGGAAGG - Intergenic
1171457001 20:25277778-25277800 CACCATCACCTAGTATGGGAAGG - Intronic
1174108925 20:48184347-48184369 CATGAGGCCCCAGACTGGGAAGG + Intergenic
1177179958 21:17734316-17734338 AATCCTCCCCCAGTATGGGTTGG - Intergenic
1178562866 21:33655534-33655556 CCTCAGCCCCCAGAGTGGGTAGG + Intronic
1179524880 21:41969381-41969403 CTTCATATCCCAGCATGGGATGG + Intergenic
1180938871 22:19643909-19643931 CATCAGCCCCCAGGGTGGGGCGG + Intergenic
1182656809 22:31897171-31897193 CAACATCCCCTAGAATGGGAAGG + Intronic
1183735416 22:39642306-39642328 CTCCATCCCCCAGTCTGGGAAGG + Intronic
1184537697 22:45098784-45098806 TATCACGCCCCAGAATGGGATGG + Intergenic
1184963262 22:47947211-47947233 TATCAACTCCCAGAACGGGAAGG - Intergenic
952728628 3:36616156-36616178 CATCATCCTCCAGTTGGGGAGGG + Intergenic
953845144 3:46420831-46420853 AATGACCCCCCAGACTGGGATGG - Intergenic
954004841 3:47582589-47582611 CACCATCCCCCAGAAAGGGAAGG + Intergenic
956245493 3:67177566-67177588 CACCATATGCCAGAATGGGATGG - Intergenic
958958738 3:100489031-100489053 CATCATGCCCAAGAATGGTCAGG + Intergenic
961493684 3:127275177-127275199 CATCAGCCCCCAAAATGTTATGG - Intergenic
963269597 3:143272724-143272746 CATCAGCTTCCAGAATGGGGAGG + Intronic
967090539 3:186131086-186131108 CATAATGCCCCAGAAATGGATGG - Intronic
970581588 4:17478395-17478417 CTTCAGCCTCCAGGATGGGAAGG - Intronic
971036131 4:22694621-22694643 CCCCATCCTCTAGAATGGGAAGG + Intergenic
972839650 4:42915246-42915268 CATCATAGCAAAGAATGGGATGG + Intronic
975823234 4:78292768-78292790 CAACATACCCCAGGATTGGAGGG + Intronic
976283003 4:83343928-83343950 CATCATCCCATAGAAAGGCAAGG + Intergenic
979829204 4:125279913-125279935 CAAAAGACCCCAGAATGGGAAGG + Intergenic
981905041 4:149912922-149912944 CATCATCTCCTAGGAAGGGAGGG - Intergenic
981941878 4:150290041-150290063 CAACATCCCACAGAAAGGAAAGG + Intronic
987856811 5:23429990-23430012 CATCATCCCCCACAATAGAAAGG - Intergenic
996753489 5:126912809-126912831 CAGCCTCCCCCAGCTTGGGAAGG + Intronic
1000027907 5:157376062-157376084 CATCCTCCTCCTGAATGGGATGG + Intronic
1000349267 5:160340500-160340522 AATAATCCCCCAGAGTAGGATGG - Intronic
1001542129 5:172547075-172547097 AACCATCCCCCAGAAAGGCAAGG + Intergenic
1002070185 5:176674368-176674390 CCCCATCCCCCACCATGGGATGG + Intergenic
1003676560 6:8210106-8210128 CATCTCCCCTCAGAATGGGAAGG - Intergenic
1004249799 6:14014578-14014600 CTTCATTTCCCAGAATGTGAGGG + Intergenic
1004459793 6:15825170-15825192 AACCATACCCCACAATGGGATGG - Intergenic
1006455673 6:34130489-34130511 CATGAACCCCCAGGATGGTAAGG + Intronic
1006607320 6:35267438-35267460 CATCAACTCCCACAATAGGAGGG - Intronic
1009229465 6:61044333-61044355 TAACATCCCTCAGACTGGGAAGG - Intergenic
1009712933 6:67347936-67347958 AATGATCCTCCAGAGTGGGATGG + Intergenic
1013820307 6:114146559-114146581 CATCAACCCCTAGAAGGGCAGGG + Intronic
1015469405 6:133586841-133586863 CATCATCCCAAAGAAGAGGATGG - Intergenic
1017281206 6:152628148-152628170 AATTATAGCCCAGAATGGGATGG - Intronic
1018279481 6:162170166-162170188 CCTCATCCCTCAGAAGGGTATGG - Intronic
1018966850 6:168496513-168496535 CATCACCCCCGAGCATGGGTAGG - Intronic
1021175350 7:17443559-17443581 CATCATACCCCAGAGTAAGATGG + Intergenic
1021956583 7:25831111-25831133 CAGCATACCCCAGGATGTGAAGG - Intergenic
1022817020 7:33923588-33923610 CAAGATACCCCAGGATGGGAGGG - Intronic
1026933550 7:74238587-74238609 CGTCATCACCCACAATGTGATGG + Intronic
1028103313 7:86847990-86848012 AATCATCCCCCACCTTGGGATGG + Intronic
1029654778 7:101917038-101917060 CATCTTCCCCTTGTATGGGAAGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1032681951 7:134194152-134194174 CATCACCAGCCAGAATGGGGTGG + Intronic
1034602135 7:152269376-152269398 CATCTTCTCCCTGACTGGGAGGG - Intronic
1037509508 8:19567450-19567472 CATCATCCACCAGAAATAGAAGG + Intronic
1037948360 8:23003516-23003538 CATCCTCCCTAGGAATGGGAAGG + Intronic
1043950009 8:86298547-86298569 CATCATCACCCAGAAGGCGAGGG + Intronic
1044318872 8:90780034-90780056 CATCAGGCCCCAGTATGGCAGGG + Intronic
1049103205 8:140594151-140594173 CACCATCTCCCTGAATGGGCAGG + Intronic
1050735907 9:8762915-8762937 ACTCATCTCCCAGCATGGGATGG + Intronic
1052705527 9:31989583-31989605 CACCATCCCCCATGATGTGATGG - Intergenic
1053304836 9:36977031-36977053 CTTCATCCTCCAGTAGGGGACGG - Intronic
1057421441 9:94916211-94916233 CATCATCGCCCTGATTGGGGAGG + Intronic
1057590127 9:96365547-96365569 CATCCTCCCCCATAAAGGCACGG + Intronic
1057957830 9:99424957-99424979 CTTCATCCCCCCAAACGGGATGG + Intergenic
1058601226 9:106672685-106672707 AATCATCACACAAAATGGGAGGG + Intergenic
1059057274 9:110996868-110996890 CATCAGACCCCAGAAGGGGAAGG - Intronic
1060061690 9:120466363-120466385 CATCATCCCCCAGAATGGGATGG - Intronic
1060416908 9:123437164-123437186 CATTATGCCCCACAATGGTAGGG + Intronic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1061843085 9:133371442-133371464 CATCATCTCCCACATTGGGCTGG - Intronic
1187409711 X:19039733-19039755 CAGCACTCACCAGAATGGGAAGG - Intronic
1192423423 X:71053899-71053921 CATCTTCCCCCAGAGTCAGATGG + Intergenic
1193902551 X:87200139-87200161 CCTCATCCCCCAGAAGGAGGTGG - Intergenic
1193999908 X:88415179-88415201 CATCCTCCCCAGGCATGGGAAGG + Intergenic
1201195188 Y:11487006-11487028 CATCATCGCACAGAATCGAATGG - Intergenic
1201767166 Y:17582752-17582774 CATTATCACCCAGAAAGGAAAGG + Intergenic
1201834387 Y:18323233-18323255 CATTATCACCCAGAAAGGAAAGG - Intergenic