ID: 1060064460

View in Genome Browser
Species Human (GRCh38)
Location 9:120491150-120491172
Sequence TCATTTGGGCTTCAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060064460 Original CRISPR TCATTTGGGCTTCAGCCACC AGG (reversed) Intronic
900883571 1:5399933-5399955 TCCTTTGAGTTTCAGCCAACAGG - Intergenic
901383038 1:8887777-8887799 TCATTGCAGCTTCAGCCTCCAGG + Intergenic
902189755 1:14754095-14754117 CCATGTGGGCTCCAGCCACGGGG + Intronic
915396762 1:155590792-155590814 ACTTTTGGGCCTCAGCCACCAGG + Intergenic
915687118 1:157644772-157644794 TCATTTGGGCACCAGACTCCAGG + Intergenic
916767839 1:167878956-167878978 TCAGTTGGTCTTCTGCCACAAGG + Intronic
916791115 1:168126023-168126045 TTATTTGGTCTTCAGACAGCTGG - Intronic
917449869 1:175138509-175138531 GCATTTGGGCTACAGACACGGGG + Intronic
917523533 1:175767626-175767648 TCATATCTGCTTCACCCACCGGG + Intergenic
919937018 1:202260111-202260133 TGATTTCGGCCTCAGCCTCCTGG + Intronic
921934440 1:220783911-220783933 TTATTCAGGCTTCAGCAACCAGG + Exonic
921961209 1:221036235-221036257 TCATTTGGGTTTTTGGCACCAGG + Intergenic
923934681 1:238747595-238747617 TCATTTGAGCCTCAGACACTGGG + Intergenic
1065113081 10:22459058-22459080 TCTTTTAGGCTGCAGGCACCGGG - Intergenic
1067094167 10:43287346-43287368 GCATTTGGGCTTCAGAGGCCAGG + Intergenic
1069902420 10:71713711-71713733 TCAATTGGGTTTCAGGCACCAGG - Exonic
1070668551 10:78362332-78362354 TCATCTGGGTGGCAGCCACCTGG + Intergenic
1070778989 10:79126739-79126761 TCCTCTGAGCTTCAGGCACCTGG + Intronic
1071090521 10:81912798-81912820 TCCTGTGTGCTTCAGCCCCCTGG - Intronic
1072604964 10:96973134-96973156 TAATTTGGATTTCAACCACCTGG + Intronic
1076277699 10:129218377-129218399 GCAAATGGGCTTCAGCAACCAGG - Intergenic
1081025454 11:38007638-38007660 TCATTTGAACTTCAGCCTCATGG - Intergenic
1082767153 11:57179339-57179361 TATTTTGGGCTCCAGCTACCAGG - Intergenic
1082927293 11:58563224-58563246 TCATTGGGGCTTCAGGGACTGGG + Intronic
1086869961 11:92025897-92025919 TTCTTTGGGCTTCAGCCTCACGG - Intergenic
1088479397 11:110280751-110280773 TCACTGCAGCTTCAGCCACCTGG - Intronic
1089284354 11:117396057-117396079 TCTTTTGAGCTTCAGCCTCCAGG - Exonic
1090874642 11:130778050-130778072 TCCTCTGGGCTTCAGCCCCGTGG - Intergenic
1091958026 12:4664601-4664623 TCCTTGGGGCTACAGCCCCCTGG + Intronic
1093563785 12:20577571-20577593 TCATTTGGGGCTAAGCCAGCTGG - Intronic
1096500661 12:52062257-52062279 ACACCTGGGCTCCAGCCACCTGG + Intergenic
1097062117 12:56293030-56293052 TCACTGCAGCTTCAGCCACCTGG - Intronic
1102245567 12:111353646-111353668 TCCTTTGGGCTTCTTCCTCCCGG - Intergenic
1103220607 12:119241446-119241468 TCATTTGGGCATCTGCCTCTTGG - Intergenic
1104491024 12:129193450-129193472 CAATTTGGGCTGCTGCCACCAGG + Intronic
1106675272 13:31951659-31951681 TCATTTGGGTTTAAGACAGCTGG - Intergenic
1109126911 13:58529169-58529191 TCATTTTGGCTTCAGCTACATGG - Intergenic
1109134815 13:58634284-58634306 TCACTTCAGCCTCAGCCACCCGG + Intergenic
1109757796 13:66784336-66784358 TCCTTTGTGCTTTAGCTACCTGG + Intronic
1111378851 13:87419208-87419230 TCATTGCAGCTTCAGCCTCCTGG + Intergenic
1113666387 13:112144333-112144355 TCATGTCTGCTTCAGCCAGCTGG + Intergenic
1114613194 14:24055281-24055303 TCTTTTGGATTTCAGCCACTTGG + Exonic
1115535164 14:34366108-34366130 TGATTGGGGCTTCAGGCTCCTGG + Intronic
1119678849 14:76576725-76576747 TCATTTGGGCTTCCTCCACCAGG - Intergenic
1120078376 14:80186574-80186596 GCATTTCTGCTTCAGCCACCAGG - Intergenic
1121045481 14:90784707-90784729 GCATTTGGGCTTCAAAAACCAGG - Intronic
1126301683 15:47203578-47203600 TCATTTAAGCTTCAACCATCTGG + Intronic
1126562125 15:50055433-50055455 TCATTTGGGTTTAAGCCTTCTGG - Intronic
1128798093 15:70479415-70479437 TCAGTTGGGGTTCAGCCATAGGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1131367106 15:91850959-91850981 TTCTTTAGGCTTCAGGCACCAGG + Intergenic
1133032004 16:3015550-3015572 GCTTTTGGGCCTCAGCCACCAGG + Exonic
1134093124 16:11402072-11402094 GCATTTGGGAGGCAGCCACCGGG - Exonic
1136396510 16:29995402-29995424 TCACTCGGGCCGCAGCCACCTGG - Exonic
1137415091 16:48269031-48269053 TCATTTTGGCTTCTGTTACCTGG + Intronic
1140792010 16:78400896-78400918 TCACTATGGCCTCAGCCACCAGG + Intronic
1141044572 16:80704787-80704809 CCCTTTTGGCTTCAGCCACGTGG - Intronic
1143629946 17:8133280-8133302 TCATTTAAGCTTCAGACTCCTGG + Intergenic
1144057030 17:11552381-11552403 TGATTTGGGCTTTAGCCTCTTGG + Intronic
1144505159 17:15823105-15823127 TCAGTTGGGCATCTGCCATCAGG + Intergenic
1145169335 17:20640988-20641010 TCAGTTGGGCATCTGCCATCGGG + Intergenic
1151728921 17:75899634-75899656 TCACCTGTCCTTCAGCCACCCGG + Exonic
1151771065 17:76161984-76162006 TCACTTCGTCTTCAGCCACCTGG + Exonic
1152475654 17:80516394-80516416 TCATTTGGGGTCCAGCTCCCAGG + Intergenic
1153052965 18:917513-917535 ACAGTTGGGTTTCAGCAACCAGG - Intergenic
1153247356 18:3085752-3085774 TCATTTGTGCTTAAGCCTCGTGG - Intronic
1154981745 18:21508213-21508235 TCATTTTGTCTTCAGCAAGCAGG + Exonic
1155252202 18:23963456-23963478 CCATATGGCCCTCAGCCACCAGG - Intergenic
1157165171 18:45352163-45352185 TCATGAGGTCTTCAGTCACCAGG + Intronic
1158093637 18:53745359-53745381 TCATTTCAGCCTTAGCCACCTGG - Intergenic
1158415761 18:57248501-57248523 TCACTTGGGGTTCAGCCCCCAGG - Intergenic
1161370734 19:3909510-3909532 TCATGTAGTCCTCAGCCACCAGG - Exonic
1161435877 19:4262546-4262568 TGTTTTGGGCTACAGCCACAGGG - Intronic
1161624253 19:5316830-5316852 TGATTTGGGGTTCTGGCACCCGG + Intronic
1163175165 19:15559492-15559514 TCATCTGGTCTTCTGTCACCCGG + Intergenic
1164790259 19:30971512-30971534 TCATTTGTGCTTCATCCAGCTGG + Intergenic
1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG + Intronic
925111386 2:1341385-1341407 GCATTCGGGCCTCAGCCATCTGG - Intronic
925771873 2:7289884-7289906 GCAATTGGGATTAAGCCACCTGG - Intergenic
925906722 2:8544231-8544253 TCATTTTGGCTTCAGGGAGCCGG - Intergenic
927093007 2:19726748-19726770 TCATTGGGGCTTATGGCACCTGG + Intergenic
930534946 2:52633456-52633478 TCAATTGAGCTTCTTCCACCTGG + Intergenic
931590430 2:63876961-63876983 CCATTTGGCCTTCAGCCAAAAGG - Intronic
935589773 2:104835766-104835788 CCATTTGGAGTCCAGCCACCCGG + Intergenic
935705075 2:105849530-105849552 GTGTTTAGGCTTCAGCCACCTGG - Intronic
941127632 2:161604845-161604867 TCATTTGGGCTTAAGCAGCAGGG + Intronic
943746002 2:191463385-191463407 GCTTTTGGGCTTCAGCCCCATGG + Intergenic
945563597 2:211368591-211368613 TCATTTTCTCTGCAGCCACCAGG - Intergenic
946022314 2:216649500-216649522 TCACTTGGGCCTCAGCAACTAGG + Intronic
946097941 2:217291700-217291722 TGCTTTGGGCTTCAGCCCCATGG + Intronic
1172026720 20:31953671-31953693 TAATTTTTCCTTCAGCCACCTGG + Intergenic
1173366162 20:42387262-42387284 TTGTTTGGCCTTCAGCCTCCTGG - Intronic
1173491912 20:43489468-43489490 ACTTTTGGGCTTCAGCCCCACGG + Intergenic
1174832211 20:53823376-53823398 CCCTTTGGGCTCCAGCCACTTGG - Intergenic
1175694158 20:61088779-61088801 TCTTTTGGGCTCCAGTCTCCTGG + Intergenic
1176364779 21:6026296-6026318 TCTTTGTGGCCTCAGCCACCTGG + Intergenic
1177412801 21:20751884-20751906 TCATTGCAGCTTCAGCCTCCTGG - Intergenic
1179758739 21:43512249-43512271 TCTTTGTGGCCTCAGCCACCTGG - Intergenic
1181465032 22:23106381-23106403 TCAGCTGGGCTTCACCCACTGGG - Intronic
1183360584 22:37381082-37381104 TCCTCTGGGCTTCAGTCTCCTGG + Intronic
1184016711 22:41791411-41791433 TCACTTTGGCTTCAACCTCCTGG - Intronic
1184429022 22:44430407-44430429 CCAGTCGAGCTTCAGCCACCTGG + Intergenic
1184739485 22:46419138-46419160 TCCTTTGGGGCTCAGCCATCGGG + Intronic
949879540 3:8650678-8650700 TCATTAAGGCTTGAGCCACAGGG - Intronic
952226816 3:31386119-31386141 TTGTTTTGGCTTCAGCCACTTGG + Intergenic
954755146 3:52835175-52835197 TCATCAGGGCTGCAGCCCCCAGG - Exonic
955837036 3:63067427-63067449 TGATTTTGGCCTCAGGCACCAGG - Intergenic
956622673 3:71236796-71236818 TCATTGCAGCCTCAGCCACCTGG - Intronic
956876629 3:73470430-73470452 TCATTTGAGCCTCATCCACTAGG + Intronic
957292510 3:78295353-78295375 GCTTTTGGGCTCCAGCCCCCTGG - Intergenic
959895681 3:111603368-111603390 TCACTGGAGCTTCAGCCTCCTGG - Intronic
961478577 3:127164567-127164589 TCATTTGTGCTTCTGCAACTGGG - Intergenic
963176129 3:142299405-142299427 TGATATGGTATTCAGCCACCTGG - Intergenic
965242809 3:166225720-166225742 TCCTTTGGGCTTCTGCCACATGG - Intergenic
966185940 3:177227366-177227388 TAAATGGGGCTTCAGCCATCAGG - Intergenic
966940390 3:184742504-184742526 TCATTTAGGCATCAGACTCCTGG - Intergenic
970224859 4:13847094-13847116 TGATTTTGGCTGCAGCCATCTGG - Intergenic
970573411 4:17404656-17404678 TCACTTTAGCTTCAGCCTCCTGG - Intergenic
972485912 4:39540537-39540559 TCAATTGGGCATCATCTACCTGG + Intergenic
972973802 4:44609339-44609361 CCATCTGGGCTGCATCCACCTGG - Intergenic
975733601 4:77360565-77360587 ACATTTGGGCTACAGCCAACAGG - Intronic
976509848 4:85895415-85895437 TCACCTGGGCTTCAGCTAGCAGG + Intronic
976806676 4:89054977-89054999 GCATTTAAGCTTCAACCACCTGG + Intronic
984643513 4:182196593-182196615 TCATTTGAGCTTAAGCCCTCGGG + Intronic
986766883 5:10936255-10936277 GGATTTGTGCATCAGCCACCAGG + Intergenic
989164428 5:38420854-38420876 TCTTGTGGGCTTCAGCTCCCTGG + Intronic
989209685 5:38846384-38846406 TCATTTAGTTTTCACCCACCAGG - Exonic
991350098 5:65712197-65712219 TCATTGCAGCCTCAGCCACCTGG - Intronic
997387386 5:133484015-133484037 TCATCCTGGCTCCAGCCACCTGG + Intronic
998143796 5:139714176-139714198 TCATCTTAGCCTCAGCCACCTGG - Intergenic
999668449 5:153937074-153937096 ACTTTTGGGCTCCAGCCACATGG + Intergenic
1000350167 5:160346776-160346798 TACTGTGGGCTTCAGCAACCAGG - Intergenic
1001271288 5:170314034-170314056 TCATTTTGGCTTCTGCCAGTTGG + Intergenic
1003356019 6:5370966-5370988 TCATTTTGACTTCAGCCATGAGG + Intronic
1006595363 6:35189157-35189179 GGATTTGGGCCTGAGCCACCAGG + Intergenic
1008465514 6:51825811-51825833 AAATTTGGGCTTCAGCTACTGGG - Intronic
1014798136 6:125748888-125748910 CCATTGGGTCTTCAGCCCCCAGG - Intronic
1015151636 6:130045749-130045771 TCATTTGAGCTTCAGGTGCCTGG + Intronic
1015746186 6:136512251-136512273 AGATTTGGGCTTCTGCCATCTGG + Intronic
1016891754 6:149014461-149014483 ACATTTGGGTTCCAGCCAACAGG + Intronic
1017013453 6:150080978-150081000 TCATTCAGGCTTCGGCTACCTGG + Intergenic
1018371962 6:163176727-163176749 TCACTTGGACTTCAGACACTGGG + Intronic
1024558422 7:50623330-50623352 TCACTAGGGCTTCACCTACCAGG + Intronic
1024578937 7:50786248-50786270 TTATTTGGTTTTTAGCCACCTGG - Intronic
1024583556 7:50821457-50821479 TCCTTTGGGCTTCAGTAACCTGG + Intergenic
1028520063 7:91720563-91720585 TCATTTGTGCTTTTGTCACCTGG - Intronic
1029497012 7:100901179-100901201 TGGTTTGGGATTCTGCCACCTGG + Intergenic
1030385207 7:108859814-108859836 TCCTTTGTCCATCAGCCACCCGG + Intergenic
1030686792 7:112495152-112495174 TCATTTGTTCTTTAGCCACTTGG - Intergenic
1031136754 7:117892952-117892974 TCATTTAAGCTTCAACCATCTGG + Intergenic
1032845107 7:135745552-135745574 TCATTTGGTCTTCATCAAACTGG + Intronic
1036748470 8:11427492-11427514 TCAGTTTGGCTCCAGGCACCAGG - Intronic
1036749925 8:11437103-11437125 TGCTTTGGGCTTCAGCTGCCAGG + Intronic
1037279593 8:17223475-17223497 ACATTTGGGATTAAGCCACGTGG - Exonic
1037892037 8:22628595-22628617 CCATTTGGGCTTCAGAAGCCAGG + Intronic
1042776319 8:72435905-72435927 TCATTTAGCATTCAGCTACCTGG + Intergenic
1042875713 8:73438480-73438502 TCAGATTGGCTGCAGCCACCAGG + Intronic
1043175465 8:77018995-77019017 TCATTTGGGGCCCAGCCAACAGG - Intergenic
1044646795 8:94452155-94452177 TCATGAGGGCTTCACCCTCCTGG + Intronic
1046593082 8:116228975-116228997 TCATTTCAGCTTCAACCTCCTGG + Intergenic
1048349927 8:133608050-133608072 ACATTTGTGCTTCACCCAGCAGG + Intergenic
1050135026 9:2453622-2453644 CCATTTCCTCTTCAGCCACCTGG - Intergenic
1056779056 9:89535779-89535801 CCAATTGTCCTTCAGCCACCAGG + Intergenic
1057953017 9:99385113-99385135 TGAGGTGGGTTTCAGCCACCAGG + Intergenic
1060064460 9:120491150-120491172 TCATTTGGGCTTCAGCCACCAGG - Intronic
1060883735 9:127136247-127136269 CCCTTTGGGCTGCAGCCAGCTGG - Intronic
1061821989 9:133234025-133234047 TCATTTGAGCGCCAGCCTCCAGG - Intergenic
1062237309 9:135516488-135516510 TCATTTGAGCGCCAGCCTCCAGG + Intergenic
1186760982 X:12721297-12721319 TGACTTGGACTTCAGCAACCTGG + Exonic
1190041757 X:47077986-47078008 AGAGTTGGCCTTCAGCCACCAGG + Intergenic
1195574836 X:106438152-106438174 TCAAGTTGGCTTCAGCTACCAGG + Intergenic
1197371177 X:125627882-125627904 TCAGTTGGGCTCCAGCCAGAAGG - Intergenic
1197632597 X:128878760-128878782 TGATTTAAGCTTCAGCCATCTGG - Intergenic
1198051311 X:132955958-132955980 CCATGTGGGGTTCAGTCACCAGG - Intronic
1198645701 X:138803568-138803590 TCCTTTGGGCTTCACCCAGTAGG - Intronic
1199461368 X:148089339-148089361 TCATTTGTGTTTCAGTCTCCTGG - Intergenic