ID: 1060066189

View in Genome Browser
Species Human (GRCh38)
Location 9:120503373-120503395
Sequence CATGGCAGCACTCTTCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060066189_1060066193 0 Left 1060066189 9:120503373-120503395 CCCTGAAGAAGAGTGCTGCCATG 0: 1
1: 0
2: 2
3: 35
4: 247
Right 1060066193 9:120503396-120503418 GCAACACAAAGACAGCAGACAGG No data
1060066189_1060066196 24 Left 1060066189 9:120503373-120503395 CCCTGAAGAAGAGTGCTGCCATG 0: 1
1: 0
2: 2
3: 35
4: 247
Right 1060066196 9:120503420-120503442 TCATGCACTTGCCACCAGTGGGG No data
1060066189_1060066194 22 Left 1060066189 9:120503373-120503395 CCCTGAAGAAGAGTGCTGCCATG 0: 1
1: 0
2: 2
3: 35
4: 247
Right 1060066194 9:120503418-120503440 GCTCATGCACTTGCCACCAGTGG No data
1060066189_1060066195 23 Left 1060066189 9:120503373-120503395 CCCTGAAGAAGAGTGCTGCCATG 0: 1
1: 0
2: 2
3: 35
4: 247
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060066189 Original CRISPR CATGGCAGCACTCTTCTTCA GGG (reversed) Intronic
900901261 1:5517881-5517903 CAGGACTGCACTCTTCTTCTGGG + Intergenic
900922368 1:5681475-5681497 CATGACAGCTTGCTTCTTCAAGG + Intergenic
901209689 1:7517848-7517870 CATGGCAGGACTTCTCTTTAAGG - Intronic
902120820 1:14164067-14164089 TATGGCAGAACTCTACTTCCAGG + Intergenic
902219050 1:14953164-14953186 CATGGCCACACCCTTCTCCAGGG + Intronic
902964302 1:19987275-19987297 CATGGCAGCTCCCTTCTTCAAGG + Intergenic
903441116 1:23388536-23388558 TATGCCAGCATTCTTCTCCATGG - Intronic
903583012 1:24386535-24386557 CATCTCAGCACTTTTCTTCGAGG + Intronic
904324373 1:29718458-29718480 CATGTTTGCACTCTTCCTCAGGG + Intergenic
906195479 1:43927930-43927952 TATGGGGGCACTCTCCTTCAGGG + Intronic
907590632 1:55665346-55665368 CATGACTTCATTCTTCTTCATGG + Intergenic
907681438 1:56567848-56567870 CATAGCAGCACTATTCATAATGG + Intronic
908246981 1:62235156-62235178 TATGGCAGTACTCTTCTGCCTGG + Intergenic
908364677 1:63408462-63408484 CATGGCAGCATTATTCGTCATGG - Intronic
909457785 1:75869768-75869790 CCAGGCAGAAGTCTTCTTCAGGG + Intronic
910444694 1:87288298-87288320 CATAGCAGCACTCTGCTTTAAGG - Intergenic
911060623 1:93744824-93744846 CATGGCAGCTTTCTTCCTAAGGG - Intronic
912027863 1:105201752-105201774 CATGGCAGCTTCCTTCTTCAAGG - Intergenic
912166559 1:107048355-107048377 CATAGCAGCTTACTTCTTCAAGG - Intergenic
912696626 1:111847107-111847129 CCTGACAGCACTCCTCGTCATGG - Intronic
913442712 1:118915847-118915869 TATAACAGCACTCTACTTCATGG + Intronic
914359979 1:146926270-146926292 TATGGCAGCACTCCACTTCCAGG + Intergenic
914493772 1:148173625-148173647 TATGGCAGCACTCCACTTCCAGG - Intergenic
914780381 1:150780396-150780418 CATGTCAGCACTCATCATCTTGG - Intergenic
914889025 1:151606511-151606533 CATGGCAGCTTGCTTCCTCAAGG + Intergenic
917268655 1:173249171-173249193 CATGACAGGACCATTCTTCAAGG + Intergenic
918218568 1:182415131-182415153 CTTGGCAGCACTGGTCTTCTGGG + Intergenic
919474873 1:198020853-198020875 CAGGGCTGCACTCTTCTTGGAGG + Intergenic
922562756 1:226580942-226580964 CAGGGCAGCTCTCTTCTACGAGG + Intronic
923496404 1:234529391-234529413 CATGGCAGCTTGCTTTTTCAAGG - Intergenic
1066315528 10:34242323-34242345 CAAGGCAGCACTCCTATTTAAGG + Intronic
1066927234 10:41713411-41713433 GAGGGCAGCACTCTCCTTAAGGG + Intergenic
1068153021 10:53158411-53158433 CATGGCAGCTTGCTTCTTCAAGG + Intergenic
1068198057 10:53744612-53744634 CATTGCAGCAGACTTCTGCATGG + Intergenic
1069266224 10:66461562-66461584 CTTGGCAGGACACTTCTTAAGGG + Intronic
1070482387 10:76895603-76895625 CATTGCATCACTCTTTTTTACGG - Intronic
1071840336 10:89464061-89464083 CATGGCAGTTTGCTTCTTCAAGG - Intronic
1072732121 10:97853253-97853275 GATGCCAGCACTCTGCTTCCTGG - Intronic
1073944287 10:108732054-108732076 CATGGTTGCACACTTCTTGAGGG - Intergenic
1074761923 10:116673399-116673421 CATGGAAGCCCTCTTCCTAAAGG + Exonic
1075421687 10:122305912-122305934 CATGCCTTCACTCTTTTTCATGG + Intronic
1076026971 10:127123425-127123447 CCTGCCAGCACTCTTCCTCGTGG - Intronic
1076288630 10:129326351-129326373 CATGGCATCACTCATCTCAATGG - Intergenic
1077267097 11:1656339-1656361 CCTGGCAGCAGCCTTGTTCAGGG + Intergenic
1078479627 11:11664592-11664614 AATGGCAGCAGTCTTCTTTTGGG - Intergenic
1078750192 11:14154282-14154304 CATGGCAGAAGTCTGCTGCAGGG - Intronic
1078956578 11:16203347-16203369 CATTACAGCACTCTTCTACATGG + Intronic
1079286882 11:19142305-19142327 CATGGCAGCTTACTTTTTCAAGG + Intronic
1079819341 11:25105586-25105608 CCAGGCAGCAGTCTTCTGCAGGG - Intergenic
1080300523 11:30779682-30779704 CTGGGCACCACTCTTCTTCTTGG + Intergenic
1081481122 11:43490265-43490287 CATGGCAGCCCTCTACTGGAGGG + Exonic
1083542236 11:63520215-63520237 AATGGCAGCAATTTTCTTCTAGG + Intergenic
1084607664 11:70181884-70181906 CATGGCAGTCCTCGCCTTCAAGG - Intronic
1086449126 11:86898976-86898998 CAGGGCATCACTCTACTTCCAGG + Intronic
1086557765 11:88131874-88131896 CATGGCAGCTTACCTCTTCAAGG - Intronic
1088721161 11:112593065-112593087 CATGGCAGCTCTCTTCCCCAAGG + Intergenic
1089628917 11:119771331-119771353 CCTGGCAGCTCACTTCTTTAAGG + Intergenic
1090022934 11:123143480-123143502 CATGGCAGCTAACTTCTTCAAGG - Intronic
1090119449 11:124009668-124009690 CATGACAGCATTCATCCTCATGG + Intergenic
1090175223 11:124642885-124642907 CATGGCAGCTTACTTCTTGAAGG - Intronic
1092223742 12:6732883-6732905 CATGGCAGCACTCTAGGCCATGG - Intergenic
1092398853 12:8154110-8154132 CCTGATAGCACTGTTCTTCATGG + Intronic
1093065001 12:14648370-14648392 CATGACAACCCTCTTTTTCATGG - Intronic
1093555591 12:20469920-20469942 CATGGCAGAACTGTTCTTTATGG + Intronic
1095323408 12:40858214-40858236 CATAGCAGCTCACTTCTTCAAGG + Intronic
1095487474 12:42699888-42699910 CATGGCTGCTTTCTTCTTAAAGG + Intergenic
1098302030 12:69064237-69064259 TATAGCAGCACCCCTCTTCATGG + Intergenic
1100116068 12:91306084-91306106 CATGGCCTCATTCTTTTTCATGG - Intergenic
1101712298 12:107279558-107279580 CATAGCAGCTTGCTTCTTCAAGG - Intergenic
1103013722 12:117477827-117477849 CATGGCAGCATTGTTCATAATGG - Intronic
1103867740 12:124066524-124066546 CATGGCAGCTTGCTTCTTCAAGG + Intronic
1103937256 12:124483245-124483267 AATGGCAGCTCTCTGCTCCACGG + Intronic
1103956706 12:124581467-124581489 CATGGCAGCATTATTCACCATGG + Intergenic
1105865305 13:24453586-24453608 CATGGCAGCAGAGTTCATCATGG - Exonic
1105933946 13:25081077-25081099 CATAGCAACATTATTCTTCATGG + Intergenic
1107723413 13:43273363-43273385 CATGGGAGCACTTTAATTCATGG - Intronic
1109011215 13:56947505-56947527 CATGGCTGCACTCTTTCTGAAGG + Intergenic
1111097111 13:83531302-83531324 CATGGCAGTTTGCTTCTTCAAGG + Intergenic
1113203078 13:107888134-107888156 CTAGGCAGAAGTCTTCTTCAGGG - Intergenic
1116028954 14:39547900-39547922 CATGGCAGCTTCCTTTTTCAAGG - Intergenic
1116660041 14:47698606-47698628 CATTGCAGCACTATTCATAATGG + Intergenic
1117835882 14:59805491-59805513 CATGGCAGCCCACTTGTCCAAGG + Intronic
1119769783 14:77213364-77213386 GCTGGCAGCACCCTCCTTCAGGG - Intronic
1120394007 14:83944562-83944584 CATGTCAGAGGTCTTCTTCATGG - Intergenic
1120657221 14:87206248-87206270 CATGAAATCACTCTACTTCAGGG - Intergenic
1121853409 14:97244743-97244765 CACGTCACCTCTCTTCTTCATGG - Intergenic
1122603316 14:102931841-102931863 CAGGTCCGCACTCTTCTGCAGGG + Intronic
1122614995 14:103011131-103011153 CTTGGCAGAACTGTTCTGCAAGG + Intronic
1122836411 14:104433018-104433040 CACAGCAGCAGTCGTCTTCAGGG + Intergenic
1124007960 15:25809889-25809911 CAGGGCAGGCCACTTCTTCATGG - Intronic
1124357932 15:29011270-29011292 CACAGCAGCACTATTCATCATGG - Intronic
1124406698 15:29399045-29399067 CATGGCAGCCCACTTCTTCAAGG - Intronic
1126200886 15:45984584-45984606 CATAGCAGCTCACTTCTCCAAGG - Intergenic
1129569132 15:76659950-76659972 CATTGCAGCACTATTCATAATGG + Intronic
1131307004 15:91253794-91253816 CATGCCCACACTCTTCTGCAAGG + Intronic
1131862407 15:96667958-96667980 CAAGGCAGATTTCTTCTTCAAGG - Intergenic
1134651597 16:15913428-15913450 CATAGCAGCACTATTCGTAACGG - Intergenic
1135609725 16:23855850-23855872 CAAAGCAGCTCCCTTCTTCAGGG + Intronic
1137690957 16:50427197-50427219 CATGCCAGTTTTCTTCTTCAGGG + Intergenic
1139066809 16:63326036-63326058 CAAGGCAGCACTGTACTACATGG - Intergenic
1140228360 16:73096778-73096800 CATGTTAAAACTCTTCTTCAAGG + Intergenic
1142945914 17:3426980-3427002 GATTGTAGCACACTTCTTCATGG + Intergenic
1146538463 17:33673714-33673736 CCTGGCAGCTCTCATCTTCAGGG + Intronic
1147232830 17:39031522-39031544 CTTGGGAGGAATCTTCTTCAGGG - Intergenic
1147972106 17:44223929-44223951 AATGCCAGCGCTCTGCTTCAAGG - Intergenic
1148403858 17:47393429-47393451 CATGGCAGCACTGATCTTAATGG + Intronic
1148606256 17:48931517-48931539 CATGGCAGCAGTAGCCTTCAAGG + Intronic
1148693664 17:49546734-49546756 CAGGGCAGGACACATCTTCAAGG + Intergenic
1155005773 18:21727819-21727841 CGTGGCAGCTTGCTTCTTCAAGG - Intronic
1155809041 18:30208412-30208434 CATGGCAGAAGTCTGCTGCAGGG - Intergenic
1155864761 18:30951567-30951589 CATGGCAGATCATTTCTTCAGGG + Intergenic
1156157036 18:34315337-34315359 CATTGCAGGATTCTTCTTCAAGG + Intergenic
1156349361 18:36290170-36290192 TATGGTAGCACTCTACTTCTAGG - Intergenic
1156377195 18:36525305-36525327 CATGGCAACTTGCTTCTTCAAGG - Intronic
1156571728 18:38263200-38263222 TATGGCAGCACTCTACTTTGAGG - Intergenic
1156910406 18:42405394-42405416 CATGGCAGCACTAATAGTCAGGG + Intergenic
1158031231 18:52967248-52967270 CATGGCCTCATTCTTTTTCATGG + Intronic
1160046964 18:75395353-75395375 CGTGGCAGCAGCCTCCTTCAAGG - Intergenic
1160139158 18:76304486-76304508 CATGGCAGCATTATTTTTAATGG - Intergenic
1160355462 18:78224629-78224651 CAATGAAGGACTCTTCTTCATGG - Intergenic
1161701046 19:5795528-5795550 CCTGGGAGATCTCTTCTTCAAGG - Intergenic
1165329612 19:35134348-35134370 GATGCCAGCACCCCTCTTCAAGG + Intronic
1168491761 19:56816882-56816904 CAAGGCGGCACTCTTATTGAAGG + Exonic
925702750 2:6655275-6655297 CATGGCAGTTGACTTCTTCAAGG - Intergenic
926735251 2:16068861-16068883 CATAGCCTCACTCTTGTTCATGG - Intergenic
927033775 2:19150670-19150692 CTTTGCAGCACGCTTCTTCCTGG + Intergenic
928383564 2:30844158-30844180 CATAGCAGCACTATTCCTAATGG + Intergenic
928853090 2:35772344-35772366 CAAGGCAGATTTCTTCTTCAGGG - Intergenic
928860889 2:35856006-35856028 CATGGCAGCTTACTTCTTCAGGG - Intergenic
932321643 2:70826664-70826686 CATGCCTGCACTTTTCTGCAAGG + Intergenic
933708107 2:85306322-85306344 AATGGCTGCACTTTCCTTCAGGG - Exonic
933769434 2:85733807-85733829 CATCCCAGGACTCATCTTCAAGG + Intergenic
936406711 2:112211093-112211115 CATGGCAGTTTACTTCTTCAAGG + Intergenic
937425878 2:121798011-121798033 CATGGCCGCCCTCTCCTGCAAGG - Intergenic
937668987 2:124518628-124518650 CATAGCAGCATTATTCTTAATGG + Intronic
939645284 2:144690074-144690096 CATGGCAGAACTGTACTTCCTGG - Intergenic
940180368 2:150925001-150925023 CATGGCAGCAGCCTGCTGCAGGG - Intergenic
940835854 2:158521019-158521041 CAAGGCAGCACTCTTTGTGAAGG - Intronic
941036900 2:160578722-160578744 CCTGGCAGCTTTCTTCTTCAAGG + Intergenic
943263198 2:185692861-185692883 CATGGCAGCTTATTTCTTCAAGG - Intergenic
943489717 2:188535620-188535642 CATTGCAGCACTATTCATAATGG - Intronic
943530773 2:189077451-189077473 CATGTCAGCACTATTTCTCAGGG - Intronic
943928599 2:193820218-193820240 CATGGCAGCAGTCATCTGGAGGG - Intergenic
945565536 2:211393925-211393947 CATGACAGCACTCTTGCTTATGG + Intronic
945981549 2:216316433-216316455 CAGGGCAGCTCTCTGATTCAAGG + Intronic
947754775 2:232554037-232554059 CAGGACAACTCTCTTCTTCAGGG - Intronic
947956667 2:234197898-234197920 CATGGCAGCAGGCTGCTTCTTGG + Intergenic
1170014397 20:11764786-11764808 CATGGCAGCACTCCCTGTCATGG + Intergenic
1170703831 20:18727488-18727510 CAGGGCCGCCCTCTCCTTCAGGG - Intronic
1170984900 20:21248487-21248509 CATGGCATCATTGGTCTTCAAGG + Intergenic
1172440449 20:34961929-34961951 CATAGCAGCATTATTCTTAATGG - Intergenic
1175508470 20:59504493-59504515 CATGGCTGCTTGCTTCTTCAAGG - Intergenic
1176217387 20:63954702-63954724 GATTGCAGCACCCTTCTCCAGGG - Intronic
1178470936 21:32892013-32892035 CATGGCAGCCTGCTTCTTCAAGG - Intergenic
1178688164 21:34728008-34728030 CATGGCAGTTTGCTTCTTCAAGG + Intergenic
1182325416 22:29509037-29509059 CATGCCAGCACTCTGCATCCTGG + Intronic
1182512377 22:30828437-30828459 CATGCCAGTCCTCTCCTTCATGG - Intronic
1182832250 22:33313604-33313626 CAGGGCAGCCCACTTCTTCAAGG - Intronic
1182904847 22:33926540-33926562 AATCGCAGCACTCTGCTTCCTGG - Intergenic
1183389758 22:37538874-37538896 CACATCAGCCCTCTTCTTCATGG - Intergenic
1184072756 22:42156120-42156142 CATGGCAGCACTGTTCTATTTGG + Intergenic
1184901436 22:47448809-47448831 CACGGCCGCACTCCTCTGCATGG - Intergenic
949699301 3:6737705-6737727 CATAGCAGCTCACATCTTCAGGG - Intergenic
951367259 3:21798478-21798500 CATGGAAGCTTGCTTCTTCAAGG + Intronic
951822851 3:26832846-26832868 CATGGCATCTTTCTTCTTCAAGG - Intergenic
952189857 3:31011231-31011253 CATGGCAGCCTTCTTCCTGAGGG + Intergenic
952307372 3:32158085-32158107 CATGGCAGCACTGTTTGTCATGG + Intronic
952307917 3:32161836-32161858 CGTGGCAGCACCCTTCTCCTGGG + Intronic
952604170 3:35124222-35124244 CATGGCAGCTTACTTCTCCAAGG + Intergenic
954377411 3:50202426-50202448 CAGGGCAGCACGCTCCTTCTGGG - Intergenic
955087902 3:55720797-55720819 CAGGGTAGCACTGTGCTTCAAGG - Intronic
956323319 3:68023477-68023499 CATGGTAGAACTGTACTTCATGG - Intronic
956814936 3:72899668-72899690 CATCGCCGGACTCTTCTTCTAGG + Intronic
957178005 3:76838051-76838073 CATGATATCACTCTTTTTCATGG - Intronic
957730638 3:84129140-84129162 CATTGCAGCACTGTTCATTATGG - Intergenic
959141043 3:102487050-102487072 TATGGCAGCAGTCTTCTGCTTGG - Intergenic
959915868 3:111816122-111816144 CCTGGCAGCAAACTTCTGCATGG - Intronic
960000217 3:112724110-112724132 CTTGGCTGCCCTCCTCTTCAAGG - Intergenic
960478622 3:118161059-118161081 CATTGCAGCACTCTTCACAATGG + Intergenic
960672651 3:120167734-120167756 GAAGGCAGCACTGTTCTTCCAGG + Exonic
960897169 3:122517047-122517069 CATGACAGCTTGCTTCTTCAAGG - Intergenic
961459090 3:127039034-127039056 CATGCCACCAGTTTTCTTCAGGG - Intergenic
962198352 3:133381545-133381567 CATGACACCACTCTGCCTCAAGG + Intronic
962735877 3:138324786-138324808 CATTGCAGCCCTTCTCTTCATGG + Intronic
962876688 3:139540573-139540595 AATGGCAGCACTGTACTCCACGG + Intergenic
964819359 3:160754453-160754475 CAGATCAGCACTCTTCTTCCTGG + Intergenic
966008868 3:175051548-175051570 CATAGCAACTTTCTTCTTCAAGG + Intronic
966376355 3:179299943-179299965 CATAGCAGCTTGCTTCTTCAAGG + Intergenic
967474673 3:189902690-189902712 CAGGGAAGCACTTTTCCTCAGGG - Intergenic
969082715 4:4632100-4632122 CCTGTCTGCTCTCTTCTTCAGGG - Intergenic
971522340 4:27569626-27569648 AGTGGCAGTACTCTTCTACAGGG - Intergenic
971760558 4:30759276-30759298 GATGTCAGCATTCTTCTTTATGG + Intronic
972003298 4:34066411-34066433 CATAGCAGGTTTCTTCTTCATGG + Intergenic
972393341 4:38634098-38634120 CATGGCAGCACTCTCCTACCTGG + Intergenic
972647107 4:40979618-40979640 CATGGCAGTTTACTTCTTCAGGG - Intronic
972825640 4:42756168-42756190 TATGGCAGAACTCATTTTCAAGG - Intergenic
972994505 4:44863708-44863730 CATGGCAGCACTCCATTTCAAGG + Intergenic
975435272 4:74344214-74344236 CCTGGCAGCAGTCTTCTGCCTGG + Intergenic
976004134 4:80408081-80408103 CATGGCAGTACTGTTCACCATGG - Intronic
978666062 4:111183220-111183242 CATGTCAGAAGTCTTCTTCATGG - Intergenic
979604210 4:122620039-122620061 CATGCCAGGCCTCTTCTTCCTGG + Intronic
979765888 4:124463553-124463575 CATGGCCACACTCTACTTCCAGG - Intergenic
981039934 4:140213688-140213710 CACAGCAGCACCCTTCTTCAAGG + Intergenic
981503094 4:145473402-145473424 CTTGGCAGCACACTTCTGCCTGG + Intergenic
981600438 4:146481827-146481849 CACAGCAGCACTGTTATTCATGG - Intronic
982125806 4:152182929-152182951 CACGGCAGGTCACTTCTTCAAGG - Intergenic
984849095 4:184137795-184137817 CATGGCAGCACTATTGGTTAGGG - Intronic
985385050 4:189436743-189436765 CCTAGCAGCCCTCCTCTTCATGG + Intergenic
985589572 5:757561-757583 CATTGCAGCACGCTTCTTACGGG - Intronic
985689789 5:1300794-1300816 CATGGAAGCACCCTTCTCAAGGG - Intergenic
987314240 5:16709470-16709492 CATGGCAGCTCACTTCTTTCAGG - Intronic
987587296 5:19872532-19872554 CATGGCAGCTTGCATCTTCAAGG - Intronic
989474106 5:41854985-41855007 CATAGCAGCACTGTTCATTATGG + Intronic
991645274 5:68795127-68795149 CATGGCACCCCTGTTCTGCAAGG - Intergenic
991768716 5:70018651-70018673 CCTGGCAGAATTCTTCTCCATGG - Intergenic
991847954 5:70893728-70893750 CCTGGCAGAATTCTTCTCCATGG - Intergenic
993184521 5:84600490-84600512 CCTGGCTGAACTCTTCTTCGAGG + Intergenic
993413192 5:87596566-87596588 CATTGCAGCAAACTTCTTCCTGG + Intergenic
996615387 5:125435353-125435375 CATGGCAGCTGGCTTCTTCAGGG + Intergenic
997822124 5:137075742-137075764 CAGGGCTGCACTCCTCTCCACGG - Intronic
998776653 5:145610643-145610665 CATGGCAGCACTTTACATCTAGG - Intronic
1001194881 5:169663504-169663526 CAAGGCAGAAGTCTTCTGCAGGG - Intronic
1002804471 6:559454-559476 CGTGGTAGGACACTTCTTCAAGG + Intronic
1005333559 6:24771578-24771600 CATGGCCGCTTGCTTCTTCAAGG + Intergenic
1006289703 6:33125335-33125357 CATGGCAGCATTTTCTTTCATGG + Intergenic
1006813125 6:36833543-36833565 CATGGCAGCTCATTTCTTCAAGG - Intronic
1006916707 6:37599407-37599429 CATGTCAGCATTTTCCTTCAAGG + Intergenic
1007029597 6:38616072-38616094 CATGGCAGCTTGCTTCTTCAAGG - Intronic
1007734981 6:43976363-43976385 CATGGCAGTTAGCTTCTTCAAGG - Intergenic
1008577465 6:52874608-52874630 CATGACAGCACTCTTCTCCCAGG + Intronic
1008580044 6:52898363-52898385 CATGACAGCACTCTTCCTCCAGG + Intronic
1009874414 6:69487328-69487350 CATAACAGCACTATTCTTAATGG + Intergenic
1009937495 6:70251038-70251060 CATAGCAGCACTTTTCATAACGG + Intronic
1010557131 6:77296305-77296327 TATTGCAGCACTATTCTCCATGG - Intergenic
1014500125 6:122177802-122177824 CATGGCCTCCCTCTTTTTCATGG - Intergenic
1014577830 6:123095197-123095219 CATGGCAGTTTGCTTCTTCAAGG + Intergenic
1014840965 6:126219491-126219513 CATACCAGCTCTCTTCTTCAAGG + Intergenic
1016745763 6:147578375-147578397 CTTAGGATCACTCTTCTTCAAGG - Intronic
1016768832 6:147826084-147826106 CATGGCAACATTTTTGTTCAAGG + Intergenic
1017647438 6:156552013-156552035 CATGGCAGCCTACTTCTTCGTGG - Intergenic
1018715983 6:166533030-166533052 CATGGAAGGACTCTGCCTCAGGG + Intronic
1019077956 6:169405644-169405666 CAAGGCTTCAGTCTTCTTCATGG - Intergenic
1019713835 7:2529507-2529529 CACGTCAGCACTCTTCTGGAGGG - Intergenic
1021682419 7:23147507-23147529 AATAGCAGCACTGTTCCTCAGGG - Intronic
1021851289 7:24810961-24810983 CATTGCAGCACTATTCATAATGG - Intronic
1021878826 7:25074117-25074139 TATGGCAGTACCCTTCTTCATGG + Intergenic
1022275912 7:28855001-28855023 CATGGCTGCGCTGTTGTTCATGG - Intergenic
1026227632 7:68456683-68456705 CATGGTTTCACTCTTTTTCATGG - Intergenic
1027336446 7:77155746-77155768 CATGCAAGCACTCTTGTTCAGGG - Intronic
1027485459 7:78756175-78756197 CATGCCAGTGCTCTCCTTCAGGG - Intronic
1028035773 7:85979989-85980011 CATAGCAGCATGCTTCTTCAAGG - Intergenic
1028720853 7:94029474-94029496 TATGGCACCACTCTTGTGCAGGG + Intergenic
1028803730 7:94999245-94999267 CTTGGCAGAAATCTTCTTTATGG + Intronic
1029779344 7:102715355-102715377 CATGCAAGCACTCTTGTTCAGGG + Intergenic
1030859604 7:114608419-114608441 CATGACAGCTTACTTCTTCAAGG + Intronic
1032852728 7:135808966-135808988 CAGAGCAGCTCTCCTCTTCATGG - Intergenic
1035385106 7:158466602-158466624 CATTGCAGCACTATTCACCAGGG - Intronic
1037288566 8:17326644-17326666 CATGGCAGCCTGTTTCTTCAAGG - Intronic
1037380162 8:18276675-18276697 CATGACAACTCTCTTCTTCTGGG + Intergenic
1037382898 8:18306987-18307009 CTTGGCAGGACACTTCTTCCCGG - Intergenic
1037802435 8:22043012-22043034 CAGGGCAGCCCTCCTCTTCCCGG + Intronic
1039913591 8:41843718-41843740 GAGAGCAGCTCTCTTCTTCAAGG + Intronic
1045034481 8:98166831-98166853 CACGGCATCACACTTCTGCAGGG + Intergenic
1045271771 8:100668274-100668296 CATTGCTGCCCTCTTCTTCTTGG + Intergenic
1046100194 8:109604982-109605004 CATGGCAGCAACATTATTCAGGG - Intronic
1046826880 8:118701637-118701659 CACGGCAACCCTCTCCTTCAGGG + Intergenic
1048041237 8:130730596-130730618 CATGGAAGCCCACTTCTTCAAGG + Intergenic
1055553775 9:77455266-77455288 CATGGCAGTATCCTTCTTCAAGG + Intronic
1055816468 9:80212808-80212830 CATGGCAGCACCCTGCTGCTTGG + Intergenic
1056107201 9:83358988-83359010 CATGACTGCTCTCTTCTACATGG + Intronic
1058891956 9:109368917-109368939 CATAGCAGCATTCTTCATAATGG - Intergenic
1059544203 9:115160124-115160146 CATGGTAGCTCTCATCTCCATGG - Intronic
1060066189 9:120503373-120503395 CATGGCAGCACTCTTCTTCAGGG - Intronic
1186547492 X:10465668-10465690 CATGGCAGCTTGCTTCGTCAAGG - Intronic
1186996662 X:15131080-15131102 TATGGCAGCATACTTCTACAAGG + Intergenic
1187656558 X:21481728-21481750 CATGGCAGCTGATTTCTTCAAGG - Intronic
1188510027 X:30925953-30925975 TATAGCAGCTCACTTCTTCAAGG - Intronic
1189911181 X:45811886-45811908 TATGGTAGGACTCTTCTTCCTGG - Intergenic
1192834239 X:74782256-74782278 CATTTCAGAACTCTTTTTCATGG - Intronic
1195543975 X:106094220-106094242 CATTGCAGCACTATTCATAATGG - Intergenic
1197532198 X:127643204-127643226 ACTGGCAGCACTCTACCTCAAGG - Intergenic
1198034910 X:132792270-132792292 CATGGCATCAATGCTCTTCAAGG + Intronic
1199197953 X:145054392-145054414 CATCGCAGCACTGTTCCCCATGG + Intergenic
1199869675 X:151887156-151887178 CATAGTAGCACCCTTCCTCATGG - Intergenic
1200342071 X:155408570-155408592 CATGGCAGCCCTTCTCATCATGG + Intergenic