ID: 1060066190

View in Genome Browser
Species Human (GRCh38)
Location 9:120503374-120503396
Sequence CCATGGCAGCACTCTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060066190_1060066196 23 Left 1060066190 9:120503374-120503396 CCTGAAGAAGAGTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1060066196 9:120503420-120503442 TCATGCACTTGCCACCAGTGGGG No data
1060066190_1060066194 21 Left 1060066190 9:120503374-120503396 CCTGAAGAAGAGTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1060066194 9:120503418-120503440 GCTCATGCACTTGCCACCAGTGG No data
1060066190_1060066193 -1 Left 1060066190 9:120503374-120503396 CCTGAAGAAGAGTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1060066193 9:120503396-120503418 GCAACACAAAGACAGCAGACAGG No data
1060066190_1060066195 22 Left 1060066190 9:120503374-120503396 CCTGAAGAAGAGTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060066190 Original CRISPR CCATGGCAGCACTCTTCTTC AGG (reversed) Intronic
900901260 1:5517880-5517902 CCAGGACTGCACTCTTCTTCTGG + Intergenic
902219049 1:14953163-14953185 CCATGGCCACACCCTTCTCCAGG + Intronic
905660396 1:39718263-39718285 CCATGTCAGCTGTTTTCTTCAGG - Intronic
907487558 1:54788041-54788063 CCATGGCAACACTCTACATCAGG - Exonic
907720659 1:56969010-56969032 CTATGGCAGCACTCCACTCCTGG + Intergenic
907837018 1:58119740-58119762 CCATGACAGCCCTCTTCCTGGGG + Intronic
908763153 1:67530813-67530835 CCACGGCTGCGCTCTTCTGCTGG - Intergenic
909113545 1:71507811-71507833 CCTTGGCATCCCCCTTCTTCTGG + Intronic
911060624 1:93744825-93744847 CCATGGCAGCTTTCTTCCTAAGG - Intronic
912450317 1:109764198-109764220 CCATGTGTGCTCTCTTCTTCTGG - Intronic
918218567 1:182415130-182415152 TCTTGGCAGCACTGGTCTTCTGG + Intergenic
920378481 1:205522227-205522249 CCATGAAAGCTTTCTTCTTCAGG - Intronic
921072681 1:211675383-211675405 CCTTGCCATCACTCTTCCTCCGG + Exonic
924178753 1:241419831-241419853 CCATGCAAGCTCTCTTCTTTTGG + Intergenic
924194505 1:241591555-241591577 CCAGGCCACCACTCTTCTCCTGG + Intronic
1066048410 10:31614242-31614264 CCATGGCACCACGCTCCTTTGGG - Intergenic
1066355285 10:34677703-34677725 GCAAGGCACCACTCTTCTCCGGG + Intronic
1068809471 10:61239628-61239650 CCTTGGAATCACTCTTCTTAAGG + Intergenic
1070436557 10:76399421-76399443 CCCTGGCAACTCTCTTCTTGTGG - Intronic
1070976462 10:80609547-80609569 CCATGGTAGCACCATTTTTCTGG + Exonic
1071103939 10:82072292-82072314 CAAAGGCAACACGCTTCTTCCGG - Intronic
1073944288 10:108732055-108732077 CCATGGTTGCACACTTCTTGAGG - Intergenic
1075330255 10:121568899-121568921 CCAGGGCAGCACCCTTCACCAGG - Intronic
1076109111 10:127847746-127847768 CCTGGGCACCACTCTTCTGCTGG + Intergenic
1076592974 10:131601839-131601861 ACATGGTATCACTCTTCTTATGG - Intergenic
1077002863 11:333414-333436 CCATTGCAGCAGTCATCTGCAGG + Intergenic
1077267095 11:1656338-1656360 CCCTGGCAGCAGCCTTGTTCAGG + Intergenic
1078479628 11:11664593-11664615 AAATGGCAGCAGTCTTCTTTTGG - Intergenic
1079143573 11:17831301-17831323 CCAGTCCAGCACTCTCCTTCAGG + Intronic
1080683436 11:34496373-34496395 CCATGGCAGGCCTCTTTTCCGGG + Intronic
1085535635 11:77215613-77215635 CCAAGGCAGCATTGTTCTTGGGG - Intergenic
1089003710 11:115073518-115073540 CCAAGGGAGTATTCTTCTTCGGG - Intergenic
1089897462 11:121945696-121945718 TCATGGCAGCAATCTTCTATAGG - Intergenic
1091787488 12:3251916-3251938 CCCTGCCAGGACTCTGCTTCAGG - Intronic
1091792364 12:3279150-3279172 GCTTGCCAGCACTCTTCCTCTGG - Intronic
1096118372 12:49069666-49069688 CCACGGCAGCGCGCCTCTTCTGG + Intronic
1096841893 12:54384907-54384929 CCCTGGCCACCCTCTTCTTCTGG + Intronic
1100176568 12:92037568-92037590 CCAGGCCAGCACTCTTCTGTGGG - Intronic
1105790059 13:23789869-23789891 CTATGGCAGCACTGCTCTCCTGG + Intronic
1108033827 13:46265762-46265784 CCATGCCAGCTCTCTCATTCAGG + Intronic
1110003527 13:70236359-70236381 TCATGACACCACTCTTCATCTGG + Intergenic
1111400045 13:87722273-87722295 CAGTGGAAGCACTTTTCTTCTGG - Intergenic
1116904827 14:50394324-50394346 CCATGGGAGCACTCCCCTGCGGG + Intronic
1122603315 14:102931840-102931862 CCAGGTCCGCACTCTTCTGCAGG + Intronic
1122836410 14:104433017-104433039 CCACAGCAGCAGTCGTCTTCAGG + Intergenic
1124497045 15:30193021-30193043 CCATGGCAGAGCCCTTCTGCTGG - Intergenic
1124746531 15:32345626-32345648 CCATGGCAGAGCCCTTCTGCTGG + Intergenic
1125542812 15:40480325-40480347 CCATGGCTGTGCTCTTCTTTGGG + Intergenic
1134410836 16:14002059-14002081 CCATGACAGCACCAGTCTTCAGG - Intergenic
1137276619 16:46938727-46938749 CCATGGCACCAGTCTTCATTAGG - Intergenic
1137423449 16:48355658-48355680 CCTTGCCAGCACTCATTTTCTGG + Exonic
1137895510 16:52207698-52207720 CCAGGGCAGAACTGTTCTCCAGG - Intergenic
1139300348 16:65940002-65940024 CGATGGCAGCACTCTACTGGAGG + Intergenic
1141074074 16:80986589-80986611 CCATGGCAACACTTTTATTGGGG - Intronic
1144740038 17:17576635-17576657 CCATGGCAGCGTTCTCCTGCAGG + Intronic
1145405050 17:22582356-22582378 CATTGGCAGCAATCTTCTTTGGG + Intergenic
1145758379 17:27409366-27409388 CCATGACAGCTGTTTTCTTCAGG - Intergenic
1146538461 17:33673713-33673735 TCCTGGCAGCTCTCATCTTCAGG + Intronic
1150130513 17:62666426-62666448 CCACGACAGCCCTCTCCTTCAGG - Intronic
1153527639 18:6012988-6013010 CCATCGCAGCACAGTTCCTCAGG + Intronic
1156370365 18:36467283-36467305 CCATGGCATAATTTTTCTTCTGG + Intronic
1158687553 18:59628521-59628543 CCATGGCAGCCCTGTTGGTCTGG - Intronic
1159118412 18:64141094-64141116 CACAGGCTGCACTCTTCTTCAGG - Intergenic
1160155949 18:76433925-76433947 CCATGGCATCACACCTCTCCTGG + Intronic
1164230689 19:23285122-23285144 CATTGGCAGCACTATTGTTCAGG - Intergenic
1165180107 19:33960186-33960208 TAAAGGCAGCTCTCTTCTTCTGG + Intergenic
1167952438 19:53038015-53038037 CCATGGCATCTCTATTTTTCGGG + Intergenic
1168634960 19:57989013-57989035 CCTTGGCAACACCCCTCTTCTGG + Intronic
925755585 2:7128468-7128490 CCCAGGCAGCACTCTCCTTTTGG + Intergenic
928436014 2:31254925-31254947 ACAGGGCAGCATACTTCTTCGGG - Intronic
928853091 2:35772345-35772367 CCAAGGCAGATTTCTTCTTCAGG - Intergenic
928860890 2:35856007-35856029 TCATGGCAGCTTACTTCTTCAGG - Intergenic
928916436 2:36477041-36477063 ACTGGGCAGCACTCTCCTTCGGG - Exonic
937097138 2:119242727-119242749 CCATGGCAGCACTTCCCTTATGG - Intronic
943530774 2:189077452-189077474 CCATGTCAGCACTATTTCTCAGG - Intronic
945980760 2:216308591-216308613 CCAGGCCTGCACTCTGCTTCCGG + Intronic
947754776 2:232554038-232554060 CCAGGACAACTCTCTTCTTCAGG - Intronic
1170703832 20:18727489-18727511 CCAGGGCCGCCCTCTCCTTCAGG - Intronic
1175881810 20:62263670-62263692 CCAGGCCAACACACTTCTTCAGG - Exonic
1177687945 21:24464869-24464891 TCATGAAAGCACTCTGCTTCCGG - Intergenic
1180957641 22:19748031-19748053 CCATGGCAGCTCTCTCCAGCTGG + Intergenic
1185320280 22:50197516-50197538 CCATCGCAGCGCTCTCCTTCTGG + Exonic
949113542 3:292679-292701 CCATGGCACCGCTCAGCTTCTGG + Intronic
951803287 3:26621275-26621297 CTATTGAAGCACTCTTATTCTGG - Intergenic
952189856 3:31011230-31011252 CCATGGCAGCCTTCTTCCTGAGG + Intergenic
952307916 3:32161835-32161857 ACGTGGCAGCACCCTTCTCCTGG + Intronic
952752557 3:36837092-36837114 ACTTGGCAGCAGCCTTCTTCTGG + Intronic
953036340 3:39214418-39214440 GCATAGCAGCAATCTTTTTCAGG - Intergenic
954377412 3:50202427-50202449 GCAGGGCAGCACGCTCCTTCTGG - Intergenic
955176429 3:56618738-56618760 CCAAGCCAGCACTGTTCCTCAGG + Intronic
957879952 3:86199626-86199648 CCATGGAAACATTCTTCTCCAGG + Intergenic
958634100 3:96720549-96720571 CCATGGCAAGACTCTTCTGAAGG + Intergenic
959959111 3:112275948-112275970 CCATGGCAGCATTCCTCTGTAGG + Intronic
960479249 3:118168929-118168951 CCATGACTGTACTCTTCTTGAGG + Intergenic
961459091 3:127039035-127039057 CCATGCCACCAGTTTTCTTCAGG - Intergenic
963741691 3:149087317-149087339 CCAGGGCCGCATTCTCCTTCCGG - Intergenic
965162758 3:165155825-165155847 CAATGGCAGCACTCTTGCTTAGG + Intergenic
965163090 3:165160332-165160354 ACATTGCAGGACACTTCTTCAGG - Intergenic
970976168 4:22045598-22045620 TTATGGCAGCACTCTATTTCTGG + Intergenic
972798270 4:42444832-42444854 CCAGGGCAGCACTGCACTTCCGG + Intronic
977009794 4:91623070-91623092 CCATGGCAGCAATAGGCTTCAGG - Intergenic
985589573 5:757562-757584 GCATTGCAGCACGCTTCTTACGG - Intronic
991603409 5:68375973-68375995 CCATGGAAGTCCTTTTCTTCTGG - Intergenic
995050653 5:107699027-107699049 CCATGGCAACAGTCTACTACAGG - Intergenic
995104633 5:108361507-108361529 CCAGGGCAGGACACTTGTTCAGG - Intronic
996615386 5:125435352-125435374 TCATGGCAGCTGGCTTCTTCAGG + Intergenic
996655119 5:125926100-125926122 CCCTGGCATCCCCCTTCTTCTGG + Intergenic
996704390 5:126482236-126482258 CCATGGCTACAATCTTGTTCTGG - Intronic
997514530 5:134477598-134477620 CAGTGTCAGCACTCTACTTCCGG - Intergenic
1003463827 6:6358039-6358061 CCATGGCAGGCCCCTTCTCCTGG - Intergenic
1003940591 6:11021446-11021468 CTTTGACAACACTCTTCTTCAGG + Intronic
1006036896 6:31221003-31221025 CCATGGCATTACTCTCTTTCTGG - Intergenic
1009628324 6:66164580-66164602 CCTTGGCATCCCTCTTCCTCAGG - Intergenic
1009913321 6:69960929-69960951 CCAGGGCTGCTTTCTTCTTCTGG + Intronic
1019254829 7:42713-42735 CCTTGGCAGCTCTCATCTGCAGG - Intergenic
1020039444 7:4990675-4990697 CCATGGAAGCACTGCTCTTTGGG + Intronic
1024879895 7:54072901-54072923 CCTTGTCAGCACTTTCCTTCTGG + Intergenic
1027336447 7:77155747-77155769 GCATGCAAGCACTCTTGTTCAGG - Intronic
1029779343 7:102715354-102715376 GCATGCAAGCACTCTTGTTCAGG + Intergenic
1035754691 8:2022595-2022617 CTGTGGCCTCACTCTTCTTCTGG - Intergenic
1037178674 8:15976472-15976494 CCATGGTACCACCCTTCTTGGGG - Intergenic
1037380161 8:18276674-18276696 CCATGACAACTCTCTTCTTCTGG + Intergenic
1038464475 8:27748530-27748552 CCATGTCAGCTGTTTTCTTCAGG + Exonic
1041738679 8:61136950-61136972 CCATGACACCACACTTCATCAGG - Intronic
1041865770 8:62571629-62571651 CCACTGCAGCAATCTTCTGCTGG + Intronic
1044323276 8:90830541-90830563 CCATGGCAGAACTGTGCTCCAGG + Intronic
1045034480 8:98166830-98166852 CCACGGCATCACACTTCTGCAGG + Intergenic
1050090649 9:2014921-2014943 CCCTGGCAGTCCTCTTCCTCGGG - Intergenic
1051511728 9:17886180-17886202 CCATAGCAGGCCTCTTTTTCTGG - Intergenic
1060066190 9:120503374-120503396 CCATGGCAGCACTCTTCTTCAGG - Intronic
1061614822 9:131772865-131772887 CCATGCCAGCACCCTTCCTTGGG + Intergenic
1188278649 X:28235364-28235386 CCATGGTAGCCTTCTTCTCCAGG - Intergenic
1190070159 X:47272958-47272980 CCATGGCAGCAATGGCCTTCTGG + Intergenic
1190440497 X:50470675-50470697 CCATGGCCGCACACCGCTTCAGG + Exonic
1192614163 X:72600894-72600916 CCATTTCACCACTCCTCTTCTGG + Intronic
1194993701 X:100571192-100571214 CCTTGGCATCCCCCTTCTTCTGG - Intergenic
1196317036 X:114239346-114239368 TTATGGCAGCACGCTACTTCTGG + Intergenic
1196624989 X:117868263-117868285 CCATGGCAGCACCTTTTTTCAGG + Intergenic
1199253806 X:145695604-145695626 CCATAGCACCCCACTTCTTCTGG - Intergenic
1201911400 Y:19136924-19136946 CTATGGAAGCACTCTTGTTATGG + Intergenic