ID: 1060066192

View in Genome Browser
Species Human (GRCh38)
Location 9:120503391-120503413
Sequence CTGCTGTCTTTGTGTTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060066192_1060066195 5 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data
1060066192_1060066199 24 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066199 9:120503438-120503460 TGGGGTTCTAATAAATGTTTTGG No data
1060066192_1060066202 29 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066202 9:120503443-120503465 TTCTAATAAATGTTTTGGGGAGG No data
1060066192_1060066196 6 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066196 9:120503420-120503442 TCATGCACTTGCCACCAGTGGGG No data
1060066192_1060066194 4 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066194 9:120503418-120503440 GCTCATGCACTTGCCACCAGTGG No data
1060066192_1060066201 26 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066201 9:120503440-120503462 GGGTTCTAATAAATGTTTTGGGG No data
1060066192_1060066200 25 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066200 9:120503439-120503461 GGGGTTCTAATAAATGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060066192 Original CRISPR CTGCTGTCTTTGTGTTGCCA TGG (reversed) Intronic
900462452 1:2808202-2808224 CGGCTGCTTTTGTGCTGCCACGG - Intergenic
902683255 1:18058690-18058712 CCGCTGCCTGTGGGTTGCCATGG - Intergenic
905680407 1:39866778-39866800 ATGGGGTCTTTGTGTTGCCTAGG - Intronic
905939638 1:41852924-41852946 CTGCTGTGTTTGTCTTCCCAAGG - Intronic
906700759 1:47856309-47856331 CTGCTGTCCTACTGCTGCCATGG + Intronic
909043271 1:70679050-70679072 CAGGGGTCTCTGTGTTGCCAAGG + Intergenic
909176684 1:72370675-72370697 CTGCCATCTATGTGTTTCCAGGG + Intergenic
912238324 1:107877119-107877141 CTGCTGCCTTTGTGTTTCAAAGG - Intronic
915835798 1:159173481-159173503 CTGCTGTCTCTGTGGTGACTAGG - Intronic
915855509 1:159381802-159381824 CTGCTGTCTTTGTCTGGCTTTGG - Intergenic
917782108 1:178409288-178409310 CTGCAAGCTTTGTGTTCCCAGGG - Intronic
918057057 1:181031211-181031233 CTTCTTTCTTTCTGTTGCCATGG + Intergenic
920434923 1:205941503-205941525 CTACTGTCCCTGTGTTTCCAGGG + Intronic
920541730 1:206783869-206783891 GTGCTGTCGTAGTGTTGCAAGGG + Intergenic
920722211 1:208398319-208398341 GTGGTCTCTTTGTGTTGCCCAGG - Intergenic
922805338 1:228383827-228383849 CTCCTGCCTTTGTCTTTCCAGGG + Intergenic
922978752 1:229806796-229806818 CTTCTGTTTTTGTTTTTCCAGGG + Intergenic
923855384 1:237839656-237839678 CTGCTGTGTTTGGGGGGCCAAGG - Intergenic
1063103659 10:2973600-2973622 CTGCTGTCTCTGTGCTGGCCTGG + Intergenic
1064879498 10:20034664-20034686 CTGTTTTGTTTTTGTTGCCATGG + Intronic
1065808349 10:29417084-29417106 CTTCAGTCTTTGTGTTTCCAGGG + Intergenic
1065933055 10:30496272-30496294 CTCATGTCTTTGGGTGGCCAAGG - Intergenic
1066134138 10:32426569-32426591 TTCTTGTCTTTCTGTTGCCAAGG - Intergenic
1067011175 10:42715253-42715275 CTGCTGGCCTTGGGTTGCCCTGG - Intergenic
1067237980 10:44467742-44467764 TTGCTGTCTTTTTGCTCCCATGG + Intergenic
1069201154 10:65618336-65618358 CTGCTATTTTTGTGCTACCATGG + Intergenic
1070836089 10:79447665-79447687 CTGCTGTCTTTGAGCTTCCAAGG + Intergenic
1070890955 10:79941954-79941976 CTGCTGCCCCTGTGTTTCCAGGG + Exonic
1072750133 10:97972535-97972557 CTGATGACTTTATGTTGCCTTGG - Intronic
1074281336 10:112054445-112054467 CTTCTGGCTTTGTGTCCCCAAGG + Intergenic
1075020688 10:118949916-118949938 CTTCTTTCTTTCTGTTCCCACGG + Intergenic
1075654269 10:124151058-124151080 CTGCTGTCATTGTGGTTCCCAGG - Intergenic
1075930604 10:126292159-126292181 CTGTAGCCTTTGAGTTGCCAGGG - Intronic
1076293022 10:129362109-129362131 CTCCTGTCTCTGCGTTTCCAGGG - Intergenic
1076326654 10:129628926-129628948 TTGCTGTCTTTGAGTTTCAATGG - Intronic
1076911351 10:133391765-133391787 CTGTTGTCTTTGTCTTGCTCCGG + Intronic
1077477094 11:2795653-2795675 CTTCTGGCTTTCCGTTGCCATGG + Intronic
1077582933 11:3428726-3428748 CTGCTTTCTTTATGTTCACAAGG + Intergenic
1078555931 11:12326125-12326147 CTGCTGTACTTGTGATTCCAGGG + Intronic
1078946196 11:16071113-16071135 CTGCTGTCTGGGTGTTTCCTGGG - Intronic
1078946219 11:16071255-16071277 CTGCTGTCTGGGTGTTTCCTGGG - Intronic
1079755050 11:24247984-24248006 ATGTTGTCTTTGTGTTGTTACGG + Intergenic
1079890173 11:26042385-26042407 CTGCTATCTGGGTGTTGCCCGGG + Intergenic
1080396184 11:31892222-31892244 CTACTGTAGTTGTGTGGCCATGG - Intronic
1081140828 11:39497237-39497259 CTGTTGAATTTGTATTGCCAGGG - Intergenic
1081631414 11:44692539-44692561 CTGCTGTGCCTGTTTTGCCAGGG + Intergenic
1082679849 11:56153857-56153879 CTGCTTTCTTGGGGTTGGCAGGG - Intergenic
1083256402 11:61498757-61498779 CTGGGGTCTTTGTGGTCCCAGGG - Intergenic
1083265351 11:61544304-61544326 CTGTTGTCTTTTGGTTCCCAGGG - Intronic
1084373997 11:68763835-68763857 CTGCTGTGATTCTGTTCCCAAGG - Intronic
1086024069 11:82268792-82268814 CTTCTGTTTTTGTTTTGCCTTGG - Intergenic
1086130110 11:83392769-83392791 CTGTTGTAGTTGTGCTGCCATGG + Intergenic
1086273650 11:85097683-85097705 AAGCTGTATTTCTGTTGCCAAGG + Intronic
1090495411 11:127206546-127206568 CTGCTGTTTGGGTGTTTCCAGGG - Intergenic
1090574480 11:128086272-128086294 CTGCTGTCTGGGTGTTTCCCGGG + Intergenic
1090712797 11:129403083-129403105 CAGCTGTCCTCGTGTTGCAATGG + Intronic
1090961361 11:131560163-131560185 CTTCTGTCTGTGAGTTGCAAAGG - Intronic
1091641746 12:2242300-2242322 TTGCTGTCTCTGTGTAGCAATGG - Intronic
1091929425 12:4382935-4382957 CTGCTGTCTCCGTGTTCCAATGG - Intergenic
1096126008 12:49120242-49120264 CTGATGTCATTGTGTTGCTAAGG - Intergenic
1096925067 12:55135294-55135316 CGGCTGTCTTGGTGTTTCCCAGG - Intergenic
1096947189 12:55420087-55420109 CTGCTGTCTATGTATTTCCCGGG + Intergenic
1097039279 12:56145028-56145050 CTGGTGTCTCTGTGCTGTCAGGG + Intergenic
1097286914 12:57885097-57885119 CTGCTGTCATTCTGTGGCCTAGG + Intergenic
1098184076 12:67878077-67878099 ATGCTGTCTTGGTGATGTCAGGG + Intergenic
1100277306 12:93082769-93082791 CTGGTGCCTTTGGGCTGCCATGG - Intergenic
1101754512 12:107610408-107610430 CGGCTGTCTCTGTCTTGCCAGGG - Intronic
1102257405 12:111424363-111424385 GTGCTGTGTTGCTGTTGCCACGG + Intronic
1103244988 12:119449037-119449059 TTGCTGTCACTGTGTTTCCAAGG + Intronic
1103652508 12:122443947-122443969 TTGGTGTCTCTGTGTTGCCCAGG + Intergenic
1103900192 12:124299819-124299841 CTGCTGCCTTTGAGCTCCCAGGG + Intronic
1104156249 12:126135977-126135999 CTGCTGTCTGTGTGCTTCCTAGG + Intergenic
1105041832 12:132967028-132967050 CTGCTGTCTTCATGGTGCCCAGG - Intergenic
1106129707 13:26930170-26930192 GTGGTGTCTCTGTGTTGCCCAGG - Intergenic
1106554213 13:30796270-30796292 CTGCTGTCTTTCCATTCCCATGG + Intergenic
1106866426 13:33969320-33969342 CTCCTGTCTCTAAGTTGCCAAGG - Intergenic
1107418820 13:40226347-40226369 CTGTTGTTTGTTTGTTGCCAGGG - Intergenic
1108161637 13:47646082-47646104 CTGCTTTCATTGTCTTGCAATGG + Intergenic
1108480463 13:50865157-50865179 CTGTTGTCTTTCTGTTTCCTAGG - Intergenic
1111605871 13:90538355-90538377 CTGCTGTCTGTGTGTTTCATAGG - Intergenic
1112067213 13:95806076-95806098 CTCCTGTCTTTGTTTAGCCTTGG - Intronic
1112628327 13:101132037-101132059 CTGCTATCTTAGTGTTTCCTTGG + Intronic
1113031029 13:105993770-105993792 CTGATTTGTTTGTGTTGCAATGG + Intergenic
1114714420 14:24809146-24809168 CAGCTGTCTCTGGGTTGGCATGG - Intergenic
1115392153 14:32866055-32866077 CTGCTCTCTGGGTGTTTCCAGGG + Intergenic
1115923803 14:38408177-38408199 GTGCTGTCATTGTGTGGACATGG - Intergenic
1115974457 14:38981335-38981357 CTCCTGTCTGTGGGTTGCAAAGG + Intergenic
1116596811 14:46859176-46859198 CTGGTTTCATTGTGCTGCCAGGG + Intronic
1117973111 14:61271773-61271795 CTGCTGACTTTGAATAGCCAGGG + Intronic
1117982042 14:61351238-61351260 CTGCTGTCTTTGTGAGGGGATGG + Intronic
1117994958 14:61469765-61469787 CTGCTAACTTTATGTTGACATGG - Intronic
1118563676 14:67115817-67115839 CGGCACTCTTTGGGTTGCCAAGG - Intronic
1119344699 14:73913804-73913826 ATGGAGTCTTTGTGTTGCCTGGG + Intronic
1119938059 14:78611116-78611138 CAGCTGTCTTCACGTTGCCATGG - Intronic
1120579604 14:86229886-86229908 CTGCTGTCCCTGTGTTGCCTGGG + Intergenic
1120981188 14:90290466-90290488 CTCCTGTCTTTATCTGGCCATGG - Exonic
1121186658 14:91978323-91978345 CTGCTATCTTTCTGTAGCCTTGG - Intronic
1121659711 14:95625618-95625640 CTGCAGCCTCTGTGTTCCCAGGG - Intergenic
1121895347 14:97641829-97641851 CTGCTGTGTTTGTCTTTCCCTGG + Intergenic
1121989748 14:98544570-98544592 CTGCTGACTCTGTGTTAGCAAGG - Intergenic
1202836450 14_GL000009v2_random:80634-80656 CTGCTGTGTGTGTGTTGCACTGG - Intergenic
1123707218 15:22959198-22959220 ATGCTGTCTGTGTGTTGCCCAGG - Intronic
1125238881 15:37550360-37550382 CTGCTGTTTATGGGTGGCCATGG + Intergenic
1125339708 15:38662623-38662645 TTCCTATCTTTGTGTTGCAATGG - Intergenic
1127203652 15:56688089-56688111 CTGCTGTGTTTGTGTAGAGATGG - Intronic
1128384494 15:67137883-67137905 CTTCTGTCTGGGTGTTGCCAGGG + Intronic
1128954828 15:71928865-71928887 CTTCTTTCTCTGTGTTGCCCAGG - Intronic
1128976180 15:72155446-72155468 CTGCTGCCTTCGTGCTGGCAGGG - Intergenic
1131615152 15:94008297-94008319 CTGCTGACTTTGGCCTGCCAGGG + Intergenic
1131658726 15:94490610-94490632 GAGATGTCTTTGTGTTGCCCAGG - Intergenic
1133031747 16:3014348-3014370 CTGCTGTTTTGGTGAGGCCAGGG - Exonic
1133555873 16:6905927-6905949 CTTCTGCCCTTGTGTTTCCAAGG + Intronic
1135410774 16:22232788-22232810 CTGTTGGGTTAGTGTTGCCAGGG + Intronic
1135543419 16:23349676-23349698 CTGTTGTATTTGTGTTGCCTAGG - Intronic
1138512124 16:57514972-57514994 CTGCTGTCTTGGTGTCACCTGGG + Intronic
1139795127 16:69476700-69476722 CTGCTGTGTTTATTTTGCCATGG + Intergenic
1139910355 16:70393824-70393846 TTGCTGCCTTCGTGTTGCTATGG + Intronic
1140069179 16:71634446-71634468 CTGCTGCCTCTTCGTTGCCATGG + Intronic
1142840491 17:2624732-2624754 CTGGTTTCTCTGTGTTGCCCAGG + Intronic
1148042875 17:44722749-44722771 CAGCTGTCTGTGTGTGCCCAGGG + Intronic
1149141925 17:53441581-53441603 CTGCTTTGTTTGGGTTCCCAAGG - Intergenic
1150175676 17:63052793-63052815 TTACTGTATTTGTGTTGCAATGG - Intronic
1151607266 17:75146050-75146072 CAGGTGTCTCTCTGTTGCCAAGG - Intronic
1151720183 17:75850626-75850648 CTCCTGTCTTTGTGAAGTCATGG + Intronic
1151910290 17:77078411-77078433 TTGCTGTCTTTCTGTTGACCAGG - Intergenic
1152503778 17:80732415-80732437 GTGCTCTCTGTGTGTTGCCAGGG + Intronic
1153561257 18:6374090-6374112 CTGCTGTTTGTGTGTTCACAGGG - Intronic
1155581664 18:27315171-27315193 CTTCTTTATTTGTGTTGGCAAGG - Intergenic
1155685638 18:28545782-28545804 TTGCTATCTGTGTATTGCCATGG + Intergenic
1155764916 18:29616501-29616523 CTACTGTCTTCGTTTTGGCATGG + Intergenic
1158531586 18:58267703-58267725 CTGCTGCCTGTGTCATGCCAGGG + Intronic
1160302154 18:77691663-77691685 AGGCTGTCTTTCTGTTGCCCAGG + Intergenic
1160897298 19:1408608-1408630 CTGCTGTGTTTACGTTGCCTCGG + Intronic
1162312251 19:9914190-9914212 CTGCCGTCTTTGGGTGGCCGGGG - Intronic
1165621949 19:37255532-37255554 CTGGTTTCATTGTGTTGGCAGGG + Intergenic
1166590354 19:43992307-43992329 CTGCTGTTTCTGTCCTGCCAAGG + Intronic
1202636189 1_KI270706v1_random:46731-46753 CTGCTGTGTGTGTGTTGCACTGG + Intergenic
925201017 2:1967903-1967925 CTGCTGTCTGTGTGTCCTCAGGG + Intronic
925626661 2:5847925-5847947 CTCATGTGTGTGTGTTGCCAGGG - Intergenic
927147449 2:20175624-20175646 CTGCTCTCACTGTGTTGCCCAGG + Intergenic
927487642 2:23499655-23499677 GTGCTGTCTCTGTGTGCCCAAGG - Intronic
927565154 2:24105189-24105211 CTGCTGTCTGTGTGCTTCCTGGG - Intronic
928022896 2:27717277-27717299 CTCCTGCCTCTGTGTTGCCCTGG + Intergenic
929057320 2:37889507-37889529 CTGTTGCCTTGGTGTGGCCATGG - Intergenic
929551150 2:42893072-42893094 CTGCTGTCCTTGTGTTCCCTGGG + Intergenic
931627333 2:64268504-64268526 CTCCTGTCTTCCTGATGCCAGGG - Intergenic
931688216 2:64812788-64812810 CTGCTTTCTATGTGTTGGTATGG + Intergenic
935211173 2:100940300-100940322 CTGGTGTCTTTCTGGTGCCCAGG + Intronic
936407774 2:112222412-112222434 CTGCTGTCTGGGTGTTTCCAGGG + Intronic
936540581 2:113347335-113347357 CTGCTCTCAAGGTGTTGCCAGGG - Intergenic
938317166 2:130337843-130337865 CTGTTGACCTTGAGTTGCCAGGG - Intergenic
939441105 2:142251021-142251043 CTGCTGTCTTCTTGTTTTCATGG - Intergenic
939850611 2:147299884-147299906 CTGCTGTCTTGATGTTATCAGGG - Intergenic
939951697 2:148483156-148483178 ATGTTGTCTTTGTGATGGCAGGG - Exonic
942394653 2:175534567-175534589 TTTCTCTCTTTGTGTTGTCATGG + Intergenic
942443101 2:176056339-176056361 CAGCTGTGTTTGCCTTGCCATGG - Intergenic
943379647 2:187128314-187128336 CTGCTTTGTTTCTTTTGCCATGG + Intergenic
944545398 2:200794551-200794573 CTGCAGGTTTTGTTTTGCCATGG + Intergenic
944865085 2:203852021-203852043 CTTCTCTCTTTGTGTTCACATGG + Intergenic
945761772 2:213923352-213923374 CTGCTGTCTGGGTGTTTCCTGGG + Intronic
1169429656 20:5525265-5525287 GTGCTGTCATTGTGTTACCCAGG - Intergenic
1170331958 20:15222836-15222858 TTGCTGCATTTGTTTTGCCAAGG + Intronic
1170569545 20:17625135-17625157 CTGCTGTCCTGGTGTGGCCTCGG - Intronic
1170613807 20:17933781-17933803 CTCCTGTCTTTGGGCTTCCATGG - Intergenic
1170843476 20:19942800-19942822 CTGGTGACATTGTGTGGCCAAGG - Intronic
1170843482 20:19942853-19942875 CTGGTGACATTGTGTGGCCAAGG - Intronic
1172039838 20:32036108-32036130 GTGCTCTCTTTATGTTGCCCAGG + Intergenic
1174163297 20:48566888-48566910 CTGTTGTGTTTGTTTTGCCAAGG - Intergenic
1174271518 20:49373022-49373044 CTGACGTCCGTGTGTTGCCAGGG - Exonic
1178697385 21:34805544-34805566 CTCCTTTCTTTGTGTTTGCATGG - Intronic
1180590271 22:16931276-16931298 CTGCTGTCTTTCCTTGGCCATGG - Intergenic
1180718138 22:17886177-17886199 TTGCTGTCTCTGTGTGGACACGG - Intronic
1180896370 22:19336643-19336665 CTGCTGTGGTGGTGGTGCCAGGG - Intronic
1181918319 22:26298750-26298772 CTGCTGTCTCTGTTTAGGCAGGG + Intronic
1182331740 22:29555842-29555864 CTGCTGTCTTGGTTTTGTCTTGG - Exonic
1183147789 22:36010437-36010459 GTGCAGTCTTTGTGGTCCCAAGG - Intronic
1184565362 22:45288650-45288672 CAGTTTTCTTTGTGATGCCAAGG + Intronic
950041832 3:9924569-9924591 GTTCTGTCTTTGTGTTCCCCTGG + Intronic
950379579 3:12600188-12600210 CCGCTCTCTTTGTGCTGGCACGG + Exonic
950684520 3:14606977-14606999 CTGTTGTCTTGGTGGTGCCCAGG + Intergenic
952629867 3:35453409-35453431 CTGCTGTCTGCATGTTTCCAGGG - Intergenic
952958844 3:38577196-38577218 TTGCTGCCTGTGTGTTGCCCGGG - Intronic
953396371 3:42574035-42574057 CTTCTGTCTGTGTGCTGGCATGG - Intronic
954351534 3:50048224-50048246 CTTCTGTCTTTGTCTTTACAGGG + Exonic
955245852 3:57224327-57224349 ATGGTGTCTCTGTGTTGCCCAGG + Intronic
955763516 3:62315478-62315500 CTGCGGTTTTTGTTTTTCCAAGG + Intergenic
956885826 3:73558682-73558704 CTGCTGTGTTTGTCTTGGAATGG - Intronic
957196208 3:77071690-77071712 CTGCTGTCTTTGCTGTTCCAGGG + Intronic
958636204 3:96750397-96750419 CTGCTGCCTTTATGGTGCCAAGG - Intergenic
959666648 3:108930223-108930245 CTGGAGTATTTGTGATGCCAGGG + Intronic
960360941 3:116710340-116710362 CGTCATTCTTTGTGTTGCCATGG - Intronic
964892847 3:161557597-161557619 CTGCTGTGTTTGTGTGTCCAAGG + Intergenic
965685023 3:171293583-171293605 CTGTTGTCTCTGTGTTGAAAAGG - Intronic
970018190 4:11536163-11536185 CTGATGTGTTTGTTTTCCCAAGG - Intergenic
970303995 4:14711964-14711986 CTGATTTGTTTGTGGTGCCATGG - Intergenic
970316040 4:14829088-14829110 GTGCTGTCTTTGTCTTTCTATGG - Intergenic
970403003 4:15735757-15735779 CTGCTGCCTTCATGTTGCCTGGG + Intronic
970509850 4:16771020-16771042 CTGCTGTGTTTATGTTGGAATGG - Intronic
972908620 4:43785051-43785073 CTGCTGTCTTCTTGCTGCTATGG + Intergenic
973365998 4:49210117-49210139 CTGCTGTGTGTGTGTTGCACTGG + Intergenic
973394600 4:49582334-49582356 CTGCTGTGTGTGTGTTGCACTGG - Intergenic
973663431 4:53132786-53132808 CTGCTGGCTTGGTGGTGACAAGG - Intronic
975584360 4:75935967-75935989 CTTCTGGCTTTGTTTTTCCAGGG + Intronic
976622107 4:87139203-87139225 CCGCTGTGTTTGTTTCGCCATGG + Exonic
979984175 4:127294673-127294695 CTGATGCATTTGTGTTCCCAGGG - Intergenic
981475322 4:145180959-145180981 CTGCTCTCCTGGTGTTTCCATGG + Intergenic
981812874 4:148795299-148795321 GTGCTGACTCTGTGTTCCCAAGG + Intergenic
982169409 4:152646415-152646437 CAGATGTTTTTCTGTTGCCATGG - Intronic
984382814 4:179016961-179016983 TTGTTTTCTTTGTGTTTCCATGG + Intergenic
984914940 4:184714088-184714110 CTGTTGTCTTCTGGTTGCCATGG - Intronic
1202763503 4_GL000008v2_random:132598-132620 CTGCTGTGTGTGTGTTGCACTGG + Intergenic
989206946 5:38819064-38819086 ATGCTGTCTTTTTTTTGGCAGGG - Intergenic
989395872 5:40955917-40955939 CACCTTTCTTTGTGTGGCCATGG + Intronic
989714993 5:44452610-44452632 CTGCTTTCTTAATCTTGCCAAGG + Intergenic
990778447 5:59330821-59330843 CTTCTCTGTTTATGTTGCCATGG + Intronic
992991363 5:82287092-82287114 CTGCTATCTTTGGGTTACTATGG + Intronic
993575109 5:89590955-89590977 CTTCTGTCTTTGTGATGGGAAGG - Intergenic
993990712 5:94654286-94654308 CTGCTTTTTTGTTGTTGCCATGG - Intronic
994515513 5:100767782-100767804 TTGCTCTCATTGTGTTGCCTAGG - Intergenic
995145692 5:108785338-108785360 CTACTGGCTCTGTGCTGCCATGG + Intronic
995372917 5:111439742-111439764 CTGCTTTTTCTGTGTTTCCAGGG - Intronic
995763252 5:115586961-115586983 CACCTGTCTTTGTCTTGCAAGGG - Intronic
996230524 5:121058313-121058335 CTGCTGTCTATCTGTGGCCTTGG - Intergenic
996525387 5:124473801-124473823 ATACTTTCTTTGTGTTGCCTTGG - Intergenic
997429747 5:133829588-133829610 GTGCTTTCCTTGTGTTGTCAGGG + Intergenic
997584688 5:135037381-135037403 TTGCTGGCTTTGTGTGGTCACGG - Intronic
997662476 5:135600059-135600081 TTGCTGTGTTTGAGTTGTCAAGG + Intergenic
999205895 5:149847744-149847766 CTTCTGTCTGTGAGTTTCCATGG + Exonic
999330537 5:150671082-150671104 CTGCTGCCTTTCTGAAGCCAAGG - Intronic
1000173309 5:158725546-158725568 CTGCTGTCTTCATGTTGTTATGG - Intronic
1000420999 5:161037658-161037680 CTGCTGGATTTGGTTTGCCAGGG - Intergenic
1000476938 5:161721652-161721674 CTGTTTTATTTGTGATGCCATGG + Intergenic
1001982888 5:176048338-176048360 CTGTTATCTTTCTGTTGCCTGGG + Intergenic
1002234575 5:177795719-177795741 CTGTTATCTTTCTGTTGCCTGGG - Intergenic
1002550747 5:179989806-179989828 CTTCTGTCTTTGTGGTTTCATGG + Intronic
1003278519 6:4672914-4672936 CTGATGCTTTTGTGTTGCCTTGG - Intergenic
1003972084 6:11309451-11309473 CTTGTTTCTTTGTGTTGCCCAGG + Intronic
1004027342 6:11831878-11831900 CTTCTGTCTCTGTCTTGCTAGGG + Intergenic
1004070210 6:12290657-12290679 CTGCTGTTTGTGGCTTGCCAAGG + Exonic
1004116226 6:12770676-12770698 GAGATGTCTTTGTCTTGCCACGG - Intronic
1004829659 6:19463375-19463397 CTCCTGTAGTTCTGTTGCCAAGG - Intergenic
1005510953 6:26511164-26511186 CTGCTGTCTTCCTTCTGCCATGG - Intergenic
1005633194 6:27728319-27728341 CTGTTGTCTTTGGGCTCCCACGG + Intergenic
1007873909 6:45072757-45072779 CATCTTTCTTTGTGTTACCAAGG + Intronic
1009684049 6:66933781-66933803 ATGCTGTCTTAGTGATGCTATGG + Intergenic
1013293026 6:108735135-108735157 CTGCTGTATCTATGTTGCCCTGG + Intergenic
1014132095 6:117846382-117846404 CTGCCATCTGGGTGTTGCCAGGG - Intergenic
1014132172 6:117846804-117846826 CTGCTGTCTGGGTGTTTCCAGGG - Intergenic
1014178587 6:118357833-118357855 CTGTTTTCTATTTGTTGCCATGG - Intergenic
1019085191 6:169468896-169468918 CTTCTGACTTTGTGTTCACATGG + Intronic
1019877097 7:3823056-3823078 GTGGGGTCTTTGTGATGCCATGG + Intronic
1021351141 7:19595654-19595676 TTTCTGGCTCTGTGTTGCCAAGG + Intergenic
1023059725 7:36315839-36315861 CTGCTGTCTGTGTGTTTCTGGGG - Intergenic
1023188460 7:37554898-37554920 CTACTGTCTTTGTGTTTTCCTGG - Intergenic
1023227810 7:37989996-37990018 GAGCTGTCTTTGTGTTTCCTGGG + Intronic
1024915593 7:54495589-54495611 ATACTGTCTTGGTGTTGCTATGG + Intergenic
1026906552 7:74066086-74066108 CTCCTGTCCTTGTGTGGACATGG - Intronic
1027950641 7:84810415-84810437 CTGCTGTTTTTGGTTTCCCAAGG - Intergenic
1028478213 7:91274817-91274839 CTTGTGGCTTTGTGTTCCCATGG + Intergenic
1030187422 7:106777577-106777599 CTTCTGCCTTCGTGTTGACATGG - Intergenic
1032612192 7:133426631-133426653 TTGCTATCTTTGCTTTGCCAAGG + Intronic
1033213365 7:139476924-139476946 CTGCTGTCTTAGCTTTGTCAAGG + Intronic
1033678115 7:143564410-143564432 CTGGTGTCCTTGTGGTGGCAGGG + Intergenic
1033691181 7:143739392-143739414 CTGGTGTCCTTGTGGTGGCAGGG - Intergenic
1033693724 7:143765034-143765056 CTGGTGTCCTTGTGGTGGCAGGG - Intergenic
1034470294 7:151251310-151251332 CTGCTGTGTGTGTGTTGGGAGGG - Intronic
1034859291 7:154582214-154582236 CAGCTGACTTTCTGTTTCCAGGG - Intronic
1037160256 8:15761214-15761236 ATGCTGTCTTTGATTTGCTAAGG - Intronic
1037891289 8:22625004-22625026 CTGCTGCTTTCATGTTGCCAAGG - Intronic
1037989207 8:23308595-23308617 CTGCTGTCTCTGTATGTCCAGGG - Intronic
1040741112 8:50577476-50577498 CTGGTGTCTTTGTGTGGCTTTGG + Intronic
1042284350 8:67091443-67091465 CTACTGTCTTTTTGTTCTCAAGG - Intronic
1043354844 8:79400453-79400475 CTGATGTCTTTGTGTGGTTAAGG - Intergenic
1044561375 8:93615648-93615670 CTGCTGTTTCTGTCCTGCCATGG - Intergenic
1045201590 8:99988645-99988667 CTCCTTCCTTTGTGTTACCATGG - Intronic
1045676500 8:104614071-104614093 CTGCTGTCCTTGTGCTTCCTGGG + Intronic
1046974511 8:120258857-120258879 CAGCTGTTTTTGAGTTGCCTTGG + Intronic
1047225727 8:122954071-122954093 TTGCTTTCTTTTCGTTGCCAGGG + Intronic
1047465826 8:125113127-125113149 CTGATATCTTTGTGTTTCCTAGG + Intronic
1049361892 8:142215900-142215922 AGGCTGGCTTTGTGGTGCCATGG + Intronic
1050459170 9:5862536-5862558 ATGGAGTCTCTGTGTTGCCAAGG + Intergenic
1050607531 9:7317124-7317146 CTGCTGTCTGTCTGTTCCTATGG + Intergenic
1051891372 9:21945626-21945648 CTGCTCTCTGGGTGTTTCCAGGG - Intronic
1052908155 9:33855574-33855596 ATGCTGATTTTGTGTTGCCTGGG - Intronic
1053455162 9:38227848-38227870 CTGCTGTCTGTCTGTTACCCTGG + Intergenic
1056683148 9:88737536-88737558 GTGCTGGCTTTGTGTAGTCAGGG - Intergenic
1057096433 9:92314509-92314531 CTTCTGTCTTTGTGGTACTATGG + Exonic
1057891822 9:98875363-98875385 CTTCTGTCTCTGTGTTCACATGG + Intergenic
1059477596 9:114560310-114560332 TTCCTGTCTTTTGGTTGCCATGG - Intergenic
1060066192 9:120503391-120503413 CTGCTGTCTTTGTGTTGCCATGG - Intronic
1062626791 9:137446938-137446960 CTGCTGTTTTTGTATTTCAAGGG + Intergenic
1203544258 Un_KI270743v1:117471-117493 CTGCTGTGTGTGTGTTGCACTGG + Intergenic
1186245714 X:7614664-7614686 CAGGTGTCTTTGTTTTGGCAAGG + Intergenic
1186478875 X:9880472-9880494 GTGCTTTCAGTGTGTTGCCAAGG + Intronic
1187925690 X:24248187-24248209 CTGTTGTCTTTGGGAGGCCAAGG - Intergenic
1189786059 X:44559735-44559757 CTGCTCTCTGTGTGTTCCCCAGG + Intergenic
1189974559 X:46448179-46448201 CTGTGGTCATTGTGTTTCCAGGG + Exonic
1189984816 X:46544610-46544632 CTGTGGTCATTGTGTTTCCAGGG - Exonic
1190369394 X:49726831-49726853 CTGCTGTTTCTGAGTTGGCAGGG + Intergenic
1193044127 X:77034019-77034041 CTGCTGTCTGGGTGTTTCCTGGG - Intergenic
1193169906 X:78323568-78323590 GGGTTGTCTTTGTGTTGTCATGG - Intronic
1193792368 X:85831218-85831240 TAGCTGATTTTGTGTTGCCATGG + Intergenic
1194982031 X:100450613-100450635 CTGCTGTCTGGGTGTTTCCATGG - Intergenic
1195771163 X:108353000-108353022 GTCCTGTCATTCTGTTGCCAAGG - Intronic
1196604445 X:117640886-117640908 CAGCTGTCATTGTGTGGCCCTGG + Intergenic
1198813980 X:140567166-140567188 CTTTCTTCTTTGTGTTGCCATGG + Intergenic
1199863153 X:151820161-151820183 GTGCTGACCTTGTGTTGGCATGG - Intergenic
1200252484 X:154560973-154560995 TTGTTGTCTTTCTGTTGCCCAGG - Intronic
1200265283 X:154643443-154643465 TTGTTGTCTTTCTGTTGCCCAGG + Intergenic
1200274193 X:154716399-154716421 CTGCTGTCCTTGTCATGACATGG - Intronic
1200871050 Y:8098847-8098869 CTGCTGGATTTGGTTTGCCAGGG + Intergenic
1201271015 Y:12253782-12253804 ATGCGGTCTTACTGTTGCCAAGG + Intergenic