ID: 1060066195

View in Genome Browser
Species Human (GRCh38)
Location 9:120503419-120503441
Sequence CTCATGCACTTGCCACCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060066189_1060066195 23 Left 1060066189 9:120503373-120503395 CCCTGAAGAAGAGTGCTGCCATG 0: 1
1: 0
2: 2
3: 35
4: 247
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data
1060066190_1060066195 22 Left 1060066190 9:120503374-120503396 CCTGAAGAAGAGTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data
1060066192_1060066195 5 Left 1060066192 9:120503391-120503413 CCATGGCAACACAAAGACAGCAG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060066195 Original CRISPR CTCATGCACTTGCCACCAGT GGG Intronic
No off target data available for this crispr