ID: 1060068673

View in Genome Browser
Species Human (GRCh38)
Location 9:120527356-120527378
Sequence CACTACCCACATGTGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060068668_1060068673 16 Left 1060068668 9:120527317-120527339 CCTTCAAAAGATTAGACCTGCAT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1060068673 9:120527356-120527378 CACTACCCACATGTGGCTCTTGG No data
1060068671_1060068673 -10 Left 1060068671 9:120527343-120527365 CCAATGCGGCAGTCACTACCCAC 0: 1
1: 0
2: 2
3: 32
4: 386
Right 1060068673 9:120527356-120527378 CACTACCCACATGTGGCTCTTGG No data
1060068670_1060068673 0 Left 1060068670 9:120527333-120527355 CCTGCATTGTCCAATGCGGCAGT 0: 1
1: 0
2: 0
3: 13
4: 91
Right 1060068673 9:120527356-120527378 CACTACCCACATGTGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060068673 Original CRISPR CACTACCCACATGTGGCTCT TGG Intronic
No off target data available for this crispr