ID: 1060069702

View in Genome Browser
Species Human (GRCh38)
Location 9:120535206-120535228
Sequence CACCTCCAAATGCTGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060069700_1060069702 24 Left 1060069700 9:120535159-120535181 CCAGATCAAAGCTAAGAAAAGAT 0: 1
1: 0
2: 0
3: 21
4: 235
Right 1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG No data
1060069701_1060069702 -8 Left 1060069701 9:120535191-120535213 CCAAATAAATGCTCGCACCTCCA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060069702 Original CRISPR CACCTCCAAATGCTGAAGCT AGG Intronic
No off target data available for this crispr