ID: 1060070681

View in Genome Browser
Species Human (GRCh38)
Location 9:120544450-120544472
Sequence TTATGCTGAACTTGCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060070681_1060070683 -5 Left 1060070681 9:120544450-120544472 CCAAGTGTGCAAGTTCAGCATAA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG No data
1060070681_1060070686 1 Left 1060070681 9:120544450-120544472 CCAAGTGTGCAAGTTCAGCATAA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1060070686 9:120544474-120544496 CTGGAGAAGAAGCCTGGGCCTGG No data
1060070681_1060070684 -4 Left 1060070681 9:120544450-120544472 CCAAGTGTGCAAGTTCAGCATAA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1060070684 9:120544469-120544491 ATAACCTGGAGAAGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060070681 Original CRISPR TTATGCTGAACTTGCACACT TGG (reversed) Intronic
900727232 1:4224727-4224749 TTATACTGAACTTGCAAGGTGGG + Intergenic
902355876 1:15899579-15899601 TTATGCTGAACTCGAACTCCTGG + Intronic
903995333 1:27301852-27301874 CTCTGCTGCACTTGTACACTCGG - Intronic
904416482 1:30364658-30364680 TTTTGCTGAACTTGGAGACATGG - Intergenic
908921667 1:69201651-69201673 TTATTCTGTAATTCCACACTTGG - Intergenic
912255586 1:108054915-108054937 TGATGTTGAACTTGCTCTCTTGG - Intergenic
914454654 1:147824573-147824595 TTCTGCTAAACTTGGAAACTTGG + Intergenic
917230479 1:172831932-172831954 TTAAACTGAACCTGAACACTTGG - Intergenic
917610252 1:176682023-176682045 TTATGCAGAACTTTCACAGGGGG + Intronic
919239032 1:194888017-194888039 TTATTATGGGCTTGCACACTGGG - Intergenic
923382002 1:233430206-233430228 TTATTCTGAAGTTGCAAACATGG - Intergenic
1064494978 10:15899668-15899690 ATCTGATGAAGTTGCACACTAGG - Intergenic
1064862968 10:19847477-19847499 TAATGCTGAATCTCCACACTTGG - Intronic
1067599261 10:47583698-47583720 TTAAGCTGAAAATGCACACAGGG - Intergenic
1067948923 10:50710283-50710305 TTAGGCTGAAGATGCACACAGGG - Intergenic
1070884241 10:79875275-79875297 TTAGGCTGAAAATGCACACAGGG - Intergenic
1071650795 10:87391575-87391597 TTAGGCTGAAAATGCACACAGGG - Intergenic
1074947741 10:118297445-118297467 TTATCCTTATCTTGCACACGAGG - Intergenic
1074973208 10:118559318-118559340 TTATTCTGAAATAGCACAGTGGG + Intergenic
1080181426 11:29430978-29431000 TTATGCTGCTCTTACAAACTAGG + Intergenic
1086160013 11:83711535-83711557 TTATTCTGAAGTAACACACTTGG + Intronic
1086728404 11:90218918-90218940 TAATGTTGAAAATGCACACTTGG - Intronic
1087118507 11:94548063-94548085 TTAAGCTTGACTTGCAAACTAGG + Exonic
1087957893 11:104312278-104312300 TTATGTTAAACTTGATCACTTGG - Intergenic
1089819190 11:121207811-121207833 TTATGCTCCACTTGCATTCTTGG + Intergenic
1091074320 11:132600889-132600911 TTAGGCTGGACTTGAACTCTTGG + Intronic
1091330841 11:134729818-134729840 CTAGGCTGGACATGCACACTGGG + Intergenic
1092028601 12:5264242-5264264 TTAGGCTGGACTTCCTCACTTGG + Intergenic
1092405472 12:8219138-8219160 GAATGCTGAACCAGCACACTGGG + Intergenic
1092462479 12:8698358-8698380 TTCCGCTGAACTCGCCCACTCGG - Intronic
1094194186 12:27728973-27728995 GTATGCTGAAATTGAGCACTTGG + Intronic
1095141989 12:38675118-38675140 TTATGCTAAATTGGCATACTGGG - Intronic
1097092249 12:56516071-56516093 TTATTCTTAACTTACACACTGGG - Intergenic
1099652977 12:85452483-85452505 TTATGCTAATCTTAAACACTTGG - Intergenic
1103239620 12:119402189-119402211 TTATTCTCACCTTGCACACAAGG + Intronic
1104691684 12:130830913-130830935 TTATCCTGTACTTCGACACTTGG - Intronic
1109458038 13:62619083-62619105 GTATGCTGCCCTGGCACACTTGG + Intergenic
1110273910 13:73621301-73621323 TTAAGGTGAAATTGCACACAGGG - Intergenic
1110999173 13:82156176-82156198 TTATACTTAACTTGCAAGCTTGG + Intergenic
1116700164 14:48231044-48231066 TTATGCACAACTTGCACACCAGG + Intergenic
1123801558 15:23826410-23826432 TGATGTTGAACTTGATCACTTGG + Intergenic
1128892299 15:71342345-71342367 TTGTGCTGGGCTTGCACTCTTGG + Intronic
1129716466 15:77854230-77854252 TTAGGCTGATCTTGAACACCTGG - Intergenic
1131640916 15:94292470-94292492 TTATGCTGAAAATACACAATTGG + Intronic
1137014926 16:35365123-35365145 TTGTGATTAACTTGCATACTTGG - Intergenic
1137040023 16:35602331-35602353 TTGGACTGAACTTGTACACTAGG - Intergenic
1138267917 16:55673314-55673336 TGATGTTAACCTTGCACACTTGG + Intronic
1141118313 16:81330801-81330823 TGATGCTGACCTTGGTCACTTGG - Intronic
1151255846 17:72875880-72875902 TTAAGCTGATATGGCACACTGGG - Intronic
1165939702 19:39408871-39408893 GAATACTGAGCTTGCACACTTGG - Exonic
927297370 2:21469999-21470021 TTAAGCTGATCTTGAACAATGGG - Intergenic
927708382 2:25310899-25310921 TGATGCTGAAGTTGCTCATTTGG + Intronic
928136647 2:28692946-28692968 TTATGAAGAACTTGCACAGTGGG + Intergenic
931383121 2:61772081-61772103 TTATGCTACACTGGGACACTTGG + Intergenic
939746482 2:145976895-145976917 TAATGGTAAACATGCACACTTGG + Intergenic
947862671 2:233372944-233372966 CTAAGCTGGACTTGGACACTGGG - Intronic
948078361 2:235184872-235184894 TCATCCTGAAATTGCACACTAGG + Intergenic
1169484697 20:6018683-6018705 TCATGCTGATCTTGAACTCTTGG + Intronic
1170259942 20:14393331-14393353 TCATAAAGAACTTGCACACTAGG - Intronic
1176674917 21:9768625-9768647 CTCTGCTGAGCTTGCGCACTTGG + Intergenic
1177499328 21:21931724-21931746 TTATGCTGAACTGGCACTGTGGG - Intergenic
1179985263 21:44917470-44917492 TTATGCTGAAATTGCTCCTTCGG + Intronic
951519889 3:23601577-23601599 TTAGGCAGAACTGGCACTCTTGG + Intergenic
954681887 3:52350348-52350370 TGATGCTGCCCTTGCACCCTGGG + Intronic
954924553 3:54220943-54220965 TTATGCTGAATTTGCCTACGAGG + Intronic
956146399 3:66195149-66195171 TTATGCTGTACTGCCACTCTTGG + Intronic
956957927 3:74362521-74362543 TTAGGTTGAACTTCCAAACTGGG + Intronic
957470068 3:80647878-80647900 TTCTGCTGAATTTGTAGACTTGG + Intergenic
957521637 3:81326124-81326146 TTAAGCTAAACTTTCACCCTTGG + Intergenic
958729740 3:97949123-97949145 TTAGGCTGCACCTCCACACTGGG - Intronic
960490336 3:118310115-118310137 TTAGGCTGAACTTCCCTACTGGG + Intergenic
961056889 3:123796679-123796701 TTATTCTTAATTTGCACTCTTGG - Intronic
964521639 3:157575641-157575663 TTCTGGTGAACCTGCCCACTTGG + Intronic
971981875 4:33762156-33762178 TTATGTTGACCTTGATCACTTGG - Intergenic
973318134 4:48782167-48782189 TTTTGCTGCACTAGCAGACTGGG + Intergenic
974108769 4:57501719-57501741 TTATGCTCAATTTGCAGACAAGG - Intergenic
974215776 4:58844982-58845004 TTATCTTTAAATTGCACACTTGG - Intergenic
976049111 4:80990127-80990149 TTTTGCTAAACTTGACCACTAGG - Intergenic
979151270 4:117318122-117318144 GTTTGCTGAAGTTGCAAACTTGG + Intergenic
980104232 4:128571922-128571944 TTTTGCTGACCTTGGACAGTTGG + Intergenic
981186235 4:141807284-141807306 TTATTCTGAAACTACACACTGGG + Intergenic
981699644 4:147594857-147594879 TTATGCTCAAATTGCAAACGGGG + Intergenic
982997807 4:162372751-162372773 TTTTGCTGAACTTCTAAACTTGG - Intergenic
984109308 4:175592436-175592458 AGGAGCTGAACTTGCACACTTGG - Intergenic
985097429 4:186427187-186427209 TAATGCTGAACTGGCTCTCTGGG - Intronic
985400637 4:189590070-189590092 CTCTGCTGAGCTTGCGCACTTGG - Intergenic
986009328 5:3698271-3698293 TTGTACTGGACTTGCCCACTGGG + Intergenic
986572321 5:9178239-9178261 TTATGTTCAATTTGCACACTTGG + Intronic
988433095 5:31142662-31142684 TTATGCTGAACTTCAGCAATAGG + Intergenic
991224484 5:64254045-64254067 ATATCCTGAGCTTGCAAACTAGG + Intronic
995795949 5:115941521-115941543 TTCTGAGCAACTTGCACACTGGG + Intergenic
999347657 5:150838673-150838695 CTAGGCTGAACATGCACACTGGG + Intergenic
1007196029 6:40061394-40061416 ATATGTGGAACTTGCCCACTGGG + Intergenic
1009286372 6:61823502-61823524 TATTTCTGAACTTGCTCACTTGG - Intronic
1009825867 6:68865518-68865540 TGATCTTGAACTTTCACACTAGG - Intronic
1010381551 6:75231444-75231466 GGATGCTGAACTTGCAGACAGGG + Intergenic
1012271297 6:97215486-97215508 TAATGCTGCATTTGCACACCGGG + Intronic
1015251690 6:131134409-131134431 TTATGCTGAAGTGGCATATTTGG + Intergenic
1016300400 6:142624239-142624261 TTATGCTGAACATGCTGACATGG - Intergenic
1016720967 6:147296534-147296556 CTATGCTGAATCTGCACATTTGG - Intronic
1018605588 6:165594785-165594807 TGATGCTAAATTTGCTCACTAGG - Intronic
1028874292 7:95803022-95803044 TTCCTCTGAACTTGTACACTGGG + Intronic
1030441048 7:109590352-109590374 TTTTGCTGAACTTGGGCAATAGG - Intergenic
1031122897 7:117741300-117741322 TTATGCTCACCTTGCTAACTTGG + Intronic
1035489174 7:159257385-159257407 TTATGCCCATGTTGCACACTGGG - Intergenic
1038729113 8:30111510-30111532 TTATGCTGAAATTCCGCATTTGG + Intronic
1039378705 8:37064075-37064097 TTATGCTAGCCTGGCACACTTGG + Intergenic
1039446005 8:37632893-37632915 TTCAGCTGAACTTTAACACTTGG - Intergenic
1042278773 8:67032133-67032155 TTATGCTGAACTTACAAATTTGG - Intronic
1043444925 8:80309943-80309965 TTGTGCTGAACTGGAACAATTGG + Intergenic
1046584313 8:116132883-116132905 TTATCATGAACTTGCAAATTGGG + Intergenic
1046816405 8:118588851-118588873 TTATGCTGAATTTTATCACTTGG + Intronic
1050943168 9:11485715-11485737 TTCTGCTGAACTAGACCACTTGG + Intergenic
1051998451 9:23247921-23247943 ATATGCTGAACTAGACCACTTGG - Intergenic
1052342790 9:27380033-27380055 TTCTGCTGAACTGGCACATCAGG - Intronic
1055017773 9:71637449-71637471 TTAAGCTGAAATATCACACTAGG - Intergenic
1056511490 9:87310254-87310276 TAATGCCTAACTTGCACAGTTGG + Intergenic
1056574203 9:87842842-87842864 TTAGGCTGAAAATGCACACAGGG + Intergenic
1058081572 9:100706344-100706366 TTTTGCTGAAGTTGCTCATTAGG + Intergenic
1060070681 9:120544450-120544472 TTATGCTGAACTTGCACACTTGG - Intronic
1188403994 X:29783788-29783810 TCATGCTGTATATGCACACTAGG + Intronic
1188664623 X:32804166-32804188 ATCTGCTGAACTTGACCACTTGG - Intronic
1192378034 X:70584719-70584741 TTATGTTGAACTTGCGTTCTTGG - Intronic
1194773911 X:97939282-97939304 TTATGCAGAAATTGCACAGATGG - Intergenic
1197388818 X:125835180-125835202 ATATGATTAACTTGCACAGTTGG - Intergenic
1197811155 X:130444411-130444433 TGATGGTGAGCTTTCACACTAGG - Intergenic
1198714989 X:139548938-139548960 TTAAGCTGAGTTTACACACTTGG + Intronic