ID: 1060070683

View in Genome Browser
Species Human (GRCh38)
Location 9:120544468-120544490
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060070681_1060070683 -5 Left 1060070681 9:120544450-120544472 CCAAGTGTGCAAGTTCAGCATAA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr