ID: 1060071046

View in Genome Browser
Species Human (GRCh38)
Location 9:120547712-120547734
Sequence CACCCATGACCTTACTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060071046_1060071047 -10 Left 1060071046 9:120547712-120547734 CCATGACAGTAAGGTCATGGGTG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1060071047 9:120547725-120547747 GTCATGGGTGTGTGAACAAAAGG No data
1060071046_1060071048 -3 Left 1060071046 9:120547712-120547734 CCATGACAGTAAGGTCATGGGTG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG No data
1060071046_1060071049 26 Left 1060071046 9:120547712-120547734 CCATGACAGTAAGGTCATGGGTG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1060071049 9:120547761-120547783 TTCTGTCTCTACTCCCTACCAGG No data
1060071046_1060071050 29 Left 1060071046 9:120547712-120547734 CCATGACAGTAAGGTCATGGGTG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1060071050 9:120547764-120547786 TGTCTCTACTCCCTACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060071046 Original CRISPR CACCCATGACCTTACTGTCA TGG (reversed) Intronic
902941246 1:19801414-19801436 CACCCATGAAGTTATTGTGAGGG + Intergenic
903197580 1:21703037-21703059 TACCCAAGCCCTCACTGTCAGGG - Intronic
908719175 1:67105682-67105704 CACACATGACCTTAAGGTCCTGG + Intronic
917456138 1:175187666-175187688 GACCCATGAGCTTAGTGTTATGG - Intronic
918222374 1:182446571-182446593 TATCCATGTCCTTACTGCCAGGG - Intergenic
919293519 1:195664213-195664235 AAGCCATGACCTGACTGACAAGG + Intergenic
922712759 1:227845629-227845651 CACCCATGACCTCTGTCTCATGG - Intronic
922825337 1:228513612-228513634 CACCCATGACCCCACAGCCACGG - Intergenic
923159096 1:231302091-231302113 GACCCATGACCTTACTTTCCCGG + Intergenic
1065302112 10:24332257-24332279 CACCCATGTCCTGCCTATCAGGG + Intronic
1072627029 10:97119214-97119236 GACCCCTGACCTTCCTGTGAGGG - Intronic
1076303537 10:129446819-129446841 CACCCAGGACCTTCCTGGCTAGG - Intergenic
1076338585 10:129727472-129727494 CACAAATGACCTTTCTTTCATGG - Intronic
1080937695 11:36881448-36881470 CATCCAAGACCTTACTGTCCCGG + Intergenic
1081996044 11:47364710-47364732 GACCCATGACCTCACTGTGGTGG + Intronic
1083292339 11:61696974-61696996 CACCCATGACCTCCCTGGGATGG + Intronic
1084976229 11:72800442-72800464 CTTCCCTGACCGTACTGTCAGGG + Intergenic
1089921425 11:122213112-122213134 TACCCATGACCCCACTGTCAGGG + Intergenic
1096183185 12:49562180-49562202 TACCCATCACCTTACTACCAGGG - Intronic
1099997296 12:89792897-89792919 CACTCATGACCTTAGTTCCAGGG + Intergenic
1104163012 12:126198977-126198999 CACCCAGGTCCTCACTCTCAGGG + Intergenic
1104561824 12:129852653-129852675 CACCCCTGATCTGACTGCCATGG - Intronic
1104835059 12:131784350-131784372 TACCCACGGCCTTTCTGTCACGG - Intronic
1110680506 13:78306321-78306343 CACCAATTACATTACAGTCAAGG + Intergenic
1114543969 14:23484810-23484832 AACCCCTCACCTTACTGTCTGGG + Intronic
1114718157 14:24850627-24850649 CAGCCATCCCCTTACTGTCATGG + Intronic
1116528788 14:45940631-45940653 CAACCATATCCTTGCTGTCATGG + Intergenic
1121181876 14:91935214-91935236 CAGCCATGTCCTCATTGTCAAGG + Intronic
1202837746 14_GL000009v2_random:90954-90976 CGACCAGGACCTTACTGACAAGG - Intergenic
1129657156 15:77531867-77531889 CACCCACGTCCTTACTGACAGGG - Intergenic
1136033903 16:27524077-27524099 TACGCATGAACTTACTTTCAAGG + Intronic
1136504911 16:30696975-30696997 CACCCATGATCTTAAGGTCAAGG - Intergenic
1137018886 16:35402902-35402924 CACCCTTGTCCCTTCTGTCATGG + Intergenic
1137441078 16:48498831-48498853 CTCCCATGAACTTAGTGTCCTGG - Intergenic
1151208824 17:72528498-72528520 CAACCTGGACCTTTCTGTCAAGG + Intergenic
1154330279 18:13423730-13423752 CACACATGTCCTTTATGTCATGG + Intronic
1157802589 18:50633063-50633085 CACCCATTTCCTTATTGTCCAGG - Intronic
1165143830 19:33719071-33719093 CACCTATGACATCACTGGCAGGG - Intronic
930251805 2:49042891-49042913 CACCCATAAACTTACTGACCAGG + Intronic
931294109 2:60904969-60904991 AAACCATGACCTTAGAGTCAGGG - Intronic
932913572 2:75830814-75830836 CACCCACTACGTTACTGACAAGG - Intergenic
935915287 2:107943117-107943139 CACACCTGACCTTAATGTCAGGG - Intergenic
940568202 2:155396188-155396210 CACCCATTACATTACTGTGGAGG + Intergenic
944941925 2:204637920-204637942 CAACCACCACCTTTCTGTCAGGG - Intronic
1169332707 20:4729325-4729347 CACCCAAGACTTTTTTGTCATGG + Intergenic
1169549528 20:6688027-6688049 TTCCCATGAAATTACTGTCATGG - Intergenic
1172244694 20:33437899-33437921 CACCCAAGACCACACTGTGAGGG + Intronic
1172478244 20:35254747-35254769 CCCTCATGGCCTTACCGTCATGG - Exonic
1174919150 20:54683303-54683325 TACCCATGATTTTACTTTCAGGG + Intergenic
1175258164 20:57659199-57659221 CACACAGGTCCTTGCTGTCATGG - Intronic
1176419126 21:6499883-6499905 CACCCATGAACTTCCTTTCCTGG - Intergenic
1176601496 21:8798844-8798866 CGACCAGGACCTTACTGACAAGG + Intergenic
1176626476 21:9095885-9095907 CGACCAGGACCTTACTGACAAGG - Intergenic
1179694619 21:43108205-43108227 CACCCATGAACTTCCTTTCCTGG - Intergenic
1180365809 22:11936844-11936866 CGACCAGGACCTTACTGACAAGG - Intergenic
1184856984 22:47151712-47151734 CACCAGTGACCTTACTCTCCTGG + Intronic
953315420 3:41922510-41922532 CACCCATGCCCTTACTCTTTCGG - Intronic
961165970 3:124764163-124764185 CCCCCATGACCTTCCTGACCTGG + Intronic
962437634 3:135381266-135381288 CACCCACGAACTTACCGGCAAGG - Intergenic
966438000 3:179910195-179910217 ATGCCATGACCTGACTGTCAAGG + Intronic
1202739765 3_GL000221v1_random:42839-42861 CGACCAGGACCTTACTGACAAGG - Intergenic
971765222 4:30822151-30822173 CTCTCATGACCTCACTATCAAGG - Intronic
972825442 4:42753522-42753544 CTCCCGAGAACTTACTGTCAGGG + Intergenic
974593187 4:63982900-63982922 CACCCATGTCCTTCCCATCAAGG + Intergenic
975576970 4:75872893-75872915 CACCAATGCCCTGACTGACATGG - Intronic
977995565 4:103494917-103494939 CACCCCTGACCTTACCCACATGG - Intergenic
981515004 4:145598079-145598101 TACCCATGACCCCACTGTCTAGG - Intergenic
981563810 4:146076475-146076497 CACCCATGAGCTTACAGGTAGGG - Intergenic
983068998 4:163247156-163247178 TGCCCATGCCCTAACTGTCAGGG - Intergenic
984124312 4:175787321-175787343 CACCCTTGACCTTACCTTCCAGG + Intronic
995408724 5:111831188-111831210 CACTCATCACTTTACTGACATGG + Intronic
998375725 5:141689326-141689348 CACCCATGACCTGTCTCCCATGG + Intergenic
1001934315 5:175693746-175693768 CAGACATGGCCTTAATGTCATGG + Intergenic
1003572653 6:7266093-7266115 CACCCTGGACTCTACTGTCAAGG + Intergenic
1005418366 6:25625054-25625076 CTTCCATGTCCTTACTGCCATGG - Intergenic
1007177355 6:39906105-39906127 CTCCCACGACCTTAGTGTCCTGG + Exonic
1017121469 6:151028156-151028178 CACACATGACGGTACTGTGAGGG - Intronic
1019408888 7:898120-898142 CACCTATCTCCTTCCTGTCAAGG - Exonic
1020643150 7:10780257-10780279 CAGCCATGGCCTTGCTGTCGTGG - Intergenic
1021096517 7:16541081-16541103 CACTCAGGCCCTTACTGTGAGGG - Intronic
1021909004 7:25365424-25365446 CAACCAAGACCTTCCTGGCAAGG - Intergenic
1022393929 7:29968733-29968755 CTCCCATGACCTTGTTTTCAAGG + Intronic
1027560515 7:79723011-79723033 CACCCATGAGTTTATTATCATGG + Intergenic
1028779773 7:94723019-94723041 CACACCTGACCTTAATGCCAGGG - Intergenic
1032980941 7:137282300-137282322 GAAACAGGACCTTACTGTCATGG - Intronic
1034215685 7:149404106-149404128 GAGCCCTGACCTCACTGTCATGG + Intergenic
1036127090 8:6072819-6072841 CACCCATGACCTTTCCTTCTTGG + Intergenic
1036513676 8:9423458-9423480 CTCTCATGAACTTACTGTCAAGG - Intergenic
1040104838 8:43535725-43535747 TGCCCAGGACCTTACTGACAAGG - Intergenic
1042848366 8:73190731-73190753 CACCCATGACAGCACTGTCATGG + Intergenic
1044252077 8:90015204-90015226 CACCCATTACTTTACAGTTATGG - Intronic
1044860440 8:96518095-96518117 TAGCCAAGACCTCACTGTCAGGG - Intronic
1047655762 8:126975160-126975182 CACCAATGACGTGACTGGCAAGG - Intergenic
1056733253 9:89183522-89183544 TCCCCATGACCTGCCTGTCATGG - Intergenic
1058837323 9:108869917-108869939 CACCCATAACCCTACATTCAAGG - Intronic
1059155764 9:111987082-111987104 CCCCCATGACCTGACTGGCATGG - Intergenic
1060071046 9:120547712-120547734 CACCCATGACCTTACTGTCATGG - Intronic
1203749648 Un_GL000218v1:66299-66321 CGACCAGGACCTTACTGACATGG - Intergenic
1185694502 X:2185143-2185165 CAGCCATTACCTTGATGTCAGGG - Intergenic
1187149992 X:16672552-16672574 CACCCAATATCTTACTGGCAAGG - Intronic
1187447376 X:19371667-19371689 CCTCCATAACCTTCCTGTCAGGG + Intronic
1188039300 X:25353517-25353539 CTCCAATGAGCTTACTGTCTGGG - Intergenic
1189480890 X:41391517-41391539 CACCCAGGGCCTTACTGGCAGGG + Intergenic
1190685397 X:52868375-52868397 CAGCCATGGCCTTGCTGTCGTGG - Intergenic
1194386282 X:93259288-93259310 CTTCCCTGACCTTATTGTCAAGG - Intergenic
1198391036 X:136174067-136174089 AACCCTTGTCCTTAGTGTCAAGG - Intronic
1198391649 X:136181177-136181199 CACCCATGGCTTTAGTGTAATGG - Intronic
1198585554 X:138116782-138116804 CACCCAAGGGCTTACTGTCTGGG - Intergenic
1200959058 Y:8980789-8980811 CACCCATGTCTTTAGTCTCATGG - Intergenic
1201163017 Y:11181314-11181336 CGACCAGGACCTTACTGACAAGG - Intergenic