ID: 1060071048

View in Genome Browser
Species Human (GRCh38)
Location 9:120547732-120547754
Sequence GTGTGTGAACAAAAGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060071046_1060071048 -3 Left 1060071046 9:120547712-120547734 CCATGACAGTAAGGTCATGGGTG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060071048 Original CRISPR GTGTGTGAACAAAAGGACAT AGG Intronic
No off target data available for this crispr