ID: 1060075504

View in Genome Browser
Species Human (GRCh38)
Location 9:120587227-120587249
Sequence TAGGTAGGAGATCTTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060075504_1060075511 28 Left 1060075504 9:120587227-120587249 CCCACGGCAAGATCTCCTACCTA No data
Right 1060075511 9:120587278-120587300 ATCCCCACCCACTTAAATCCAGG No data
1060075504_1060075508 1 Left 1060075504 9:120587227-120587249 CCCACGGCAAGATCTCCTACCTA No data
Right 1060075508 9:120587251-120587273 ATTGATCATCCTCAGTACGATGG No data
1060075504_1060075512 29 Left 1060075504 9:120587227-120587249 CCCACGGCAAGATCTCCTACCTA No data
Right 1060075512 9:120587279-120587301 TCCCCACCCACTTAAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060075504 Original CRISPR TAGGTAGGAGATCTTGCCGT GGG (reversed) Intergenic
No off target data available for this crispr