ID: 1060081454

View in Genome Browser
Species Human (GRCh38)
Location 9:120650656-120650678
Sequence CCTCATATATTGAAAGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060081454 Original CRISPR CCTCATATATTGAAAGTCTA TGG (reversed) Intronic
906065559 1:42978070-42978092 CCCCATATATTGGAGGTCTGGGG - Intergenic
909468872 1:76003968-76003990 CCTCATCTTGTGTAAGTCTATGG - Intergenic
911486136 1:98507696-98507718 ACACATAGATTGAAAGTGTAGGG + Intergenic
914820929 1:151102413-151102435 TTTCATATATTGAATGTCAAAGG - Intronic
915181451 1:154064630-154064652 CCTCATATACTTATAGTCTAAGG - Intronic
919086040 1:192920889-192920911 TCTCATTTATTGAGTGTCTATGG - Intergenic
920601383 1:207328439-207328461 CCTCATGTGTTTATAGTCTAGGG - Intronic
921246254 1:213244613-213244635 CCACATATATTAAAACTCTCAGG - Intronic
921595014 1:217045409-217045431 ACTCATATATTCAAAGTGAAAGG + Intronic
1063784365 10:9364031-9364053 TCTCATACCTGGAAAGTCTAGGG - Intergenic
1065614673 10:27507700-27507722 CCTCATATTTTCAAAGTTAAAGG - Intronic
1066597766 10:37070758-37070780 CCTCATAGTTTCAAAGTATATGG - Intergenic
1068354239 10:55890302-55890324 CCTCCTATATTGTATGTATATGG + Intergenic
1069305524 10:66964233-66964255 CCTCATACTTTAAATGTCTAAGG - Intronic
1070192918 10:74128919-74128941 ACTCATACATTCAAAGTATACGG + Intronic
1073010408 10:100354702-100354724 GCTTATATTTTGAAAGTCTCAGG - Intronic
1078718013 11:13858191-13858213 CCTTCTATACTGTAAGTCTATGG + Intergenic
1079938111 11:26642944-26642966 CTGAATGTATTGAAAGTCTATGG - Intronic
1085892030 11:80591577-80591599 CCTCATAGTTTCAAAGTATATGG + Intergenic
1085993946 11:81888067-81888089 TATCATATATAGAAATTCTATGG + Intergenic
1088983974 11:114889504-114889526 TCCCATATCTGGAAAGTCTAAGG + Intergenic
1089234615 11:117012804-117012826 CATAATATATTGAAATTCTTAGG + Intronic
1090977511 11:131689933-131689955 CCACATATGATGAAATTCTATGG + Intronic
1094278909 12:28712195-28712217 ACTGATATTTTGAAAGTCAATGG + Intergenic
1094285042 12:28783338-28783360 CCTCATATATTTAAAAGCAAGGG + Intergenic
1096191018 12:49619358-49619380 CTTCATATGATGAAAATCTAGGG + Intronic
1096484974 12:51973885-51973907 GCTCATTTATAGAAAGCCTAAGG + Intronic
1101275108 12:103190858-103190880 CCTCATATTTGGGAAGTTTATGG - Intergenic
1106293905 13:28392483-28392505 GCTCATAAATGGAAAGTCTGTGG - Intronic
1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG + Intronic
1110509378 13:76330975-76330997 ACTCATATGTGCAAAGTCTATGG - Intergenic
1113210458 13:107973122-107973144 CTTCATATATTGAGAGTCTCTGG - Intergenic
1113820762 13:113210360-113210382 ACTCATATTTTGCAAGTATACGG + Intronic
1115969466 14:38929282-38929304 CCCAATATTTTGAAAGTCCAAGG + Intergenic
1117195414 14:53335526-53335548 CTTCTTATATTGGAAGTCAATGG - Intergenic
1117863931 14:60125148-60125170 GGTCATATATTGAGAGTTTACGG + Exonic
1118244159 14:64092327-64092349 CCTCATATATTTCAAAGCTAAGG + Intronic
1122431641 14:101653224-101653246 TCTCATATGTAGAAAATCTAAGG + Intergenic
1125478665 15:40064850-40064872 CCACCCACATTGAAAGTCTAAGG + Intergenic
1125870629 15:43098429-43098451 CTTTACAAATTGAAAGTCTATGG - Intronic
1128876378 15:71204740-71204762 CCTCTTTTATTAAAAGTATACGG + Intronic
1139300237 16:65938851-65938873 TCTCATCTATTGAGAGACTATGG - Intergenic
1140317575 16:73913903-73913925 CCACAGATACAGAAAGTCTAGGG + Intergenic
1143941865 17:10550985-10551007 CCTGATCTATTCAAAGTCTAAGG + Intergenic
1144338210 17:14291044-14291066 ATTCATATATTGAAACTTTATGG - Intergenic
1150102410 17:62435487-62435509 GTTCATATATTGAAAGTTTGTGG + Intronic
1156810456 18:41243539-41243561 CCACATGCATTTAAAGTCTAAGG - Intergenic
1157008510 18:43617223-43617245 CCTAATTTATTGAGAGTCTTTGG + Intergenic
1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG + Intronic
925775918 2:7335735-7335757 CCTCAAATATTGAATGTCCAGGG - Intergenic
929336798 2:40758094-40758116 AAACATATAATGAAAGTCTAAGG - Intergenic
931993138 2:67810597-67810619 CCTCACAAATTGACATTCTAAGG + Intergenic
932839968 2:75072820-75072842 CCTCAAATCTTCAAGGTCTATGG + Intronic
935162091 2:100538016-100538038 CCTTGTATATTAAAAGGCTAGGG - Intergenic
938772691 2:134513813-134513835 CCTCTTGGATTGAAAGTCCAGGG - Intronic
940502949 2:154517443-154517465 CTTCATATATTAAAAGTCAGAGG - Intergenic
941044599 2:160658700-160658722 CCCCAGAAATTGAAAGTATATGG + Intergenic
944668795 2:201978354-201978376 CCTTTTCTATTGAAAGACTAAGG - Intergenic
945946083 2:215997246-215997268 CCTTGTTTATTGAAAGTCTTTGG - Intronic
1177706916 21:24717907-24717929 CCACAAATATTAAAAGTATATGG - Intergenic
1179536405 21:42055580-42055602 CCTCATGTATGGAAAGTCCTGGG - Intergenic
1181731013 22:24846779-24846801 CCTCAAATATTTTAAATCTATGG + Intronic
1183771911 22:39933969-39933991 CCTCACAAAAGGAAAGTCTATGG + Intronic
949732889 3:7134354-7134376 CCTCATATTTTGAAAATATTAGG - Intronic
950326684 3:12116999-12117021 CTCCATATTTTGAAAGGCTAAGG - Intronic
957827440 3:85467416-85467438 CCTCAAATATTGGAAATTTAAGG + Intronic
958914498 3:100033725-100033747 CCTGATATATTGAAAATATGTGG + Intronic
959734437 3:109641827-109641849 CCTCATCTTTTGAAACTCTTTGG - Intergenic
963476369 3:145809981-145810003 CCTCATACTTTTACAGTCTAGGG - Intergenic
970174108 4:13321055-13321077 ACACAAATATTGAAAGCCTATGG - Intergenic
970649642 4:18162098-18162120 CCTCATATATTGCAATGATAAGG + Intergenic
970702224 4:18755704-18755726 CCTCATTCATTGAAACTTTAAGG + Intergenic
970757033 4:19439012-19439034 CCTGATGTGTTGAAAGTTTATGG + Intergenic
972833096 4:42836726-42836748 CCACATATATTCACAGTCCAGGG + Intergenic
976542328 4:86293194-86293216 CCTCAAAGTTTGAAATTCTAGGG - Intronic
977069642 4:92368350-92368372 CATCATATTTGGAAAGTCTCAGG - Intronic
977104795 4:92868170-92868192 CTTAATATATTCAAAGTTTATGG - Intronic
978414981 4:108465310-108465332 TCTCATAATTTGAAAGTCTCTGG - Intergenic
982563540 4:156961173-156961195 CCATATATATTCATAGTCTAGGG - Intronic
982877745 4:160668815-160668837 TCTCATATTTTGAAACTCTAGGG - Intergenic
985316677 4:188665470-188665492 CCCCAAATAATGTAAGTCTAAGG + Intergenic
990046538 5:51439576-51439598 CATCAAATATTTAAAGTCTAAGG - Intergenic
990964234 5:61427782-61427804 CCTCAAATATTTTAAATCTATGG + Intronic
991589368 5:68233437-68233459 CCTCCTCTATTGAAAGCCTAAGG - Intronic
994793898 5:104268516-104268538 CATCATATATTGAAATTAAATGG + Intergenic
994992805 5:107018574-107018596 CTTCATATTTTGAAAGTCTTTGG - Intergenic
996620312 5:125493448-125493470 CTTCATACTTTGAAATTCTATGG + Intergenic
996929644 5:128870501-128870523 CCTCCTAAATTGAATGTCTGTGG - Intronic
998200712 5:140116523-140116545 ACTCATATATTCAAGGTGTAGGG + Exonic
1000177758 5:158774552-158774574 CCTCACATCTTGAAATACTATGG + Intronic
1000558026 5:162751136-162751158 TCACATAATTTGAAAGTCTATGG - Intergenic
1004891264 6:20102719-20102741 CCCCCAATATTCAAAGTCTAAGG + Intronic
1005198647 6:23318201-23318223 CCTCATGTTTTGCAAGTCAATGG - Intergenic
1010024256 6:71197404-71197426 CCTGATATGTTGAAATTATATGG - Intergenic
1010125102 6:72422176-72422198 ACTCATATAATGAAACTCTAGGG + Intergenic
1011642255 6:89426647-89426669 CCTCATATCTAGAAAGTATAAGG + Intergenic
1011920117 6:92564026-92564048 ACACATATATTGAAAGTGAAGGG - Intergenic
1013999940 6:116353589-116353611 CCTCATCTTTTGAGAGTATAAGG - Intronic
1014323695 6:119965595-119965617 CCTTATCTATTGCAAGTTTATGG - Intergenic
1018501388 6:164414299-164414321 CCTCATATTTTGAGACTCTCTGG + Intergenic
1022265657 7:28751856-28751878 CGTCATGGATTGGAAGTCTAAGG - Intronic
1024829625 7:53434999-53435021 ACTCATGTATTTAAAGTCAAAGG - Intergenic
1028112195 7:86954392-86954414 CCTCATGTTTTGAAAGACTATGG + Intronic
1032031557 7:128488356-128488378 GTTCATATATTGAAAGTCTGTGG + Intronic
1032978198 7:137250105-137250127 ACTCATATATTTTAACTCTAAGG - Intronic
1034046902 7:147939251-147939273 CCTCATAGATTTAAAATGTATGG - Intronic
1038709104 8:29924580-29924602 CATCATGTATTGAATGTGTAAGG + Intergenic
1039294880 8:36139714-36139736 TCTCATATATTGCAAGAATACGG - Intergenic
1042095402 8:65210322-65210344 CCTAATATATAGAAAATTTAAGG + Intergenic
1042703745 8:71644649-71644671 CCGTATCTATTGAAAGACTAAGG + Intergenic
1044397814 8:91734436-91734458 CACCATATCTTGAAAGTCAAAGG - Intergenic
1047373121 8:124272677-124272699 GCTCATCTATGGAAGGTCTAAGG - Intergenic
1050171090 9:2817624-2817646 CCACATATAGTGAAAGGATAAGG + Intronic
1050171664 9:2825778-2825800 CCCTATATTTTCAAAGTCTAAGG + Intronic
1052224654 9:26070823-26070845 ACTCATATTTTGAAATTCAAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057598851 9:96439681-96439703 CATCATATATAAATAGTCTACGG - Intergenic
1058886344 9:109324115-109324137 CATCAAATATTGAAATTCTAAGG - Intergenic
1060081454 9:120650656-120650678 CCTCATATATTGAAAGTCTATGG - Intronic
1186429182 X:9489795-9489817 CCTCCCATAGTGGAAGTCTATGG - Intronic
1188959843 X:36477859-36477881 ACTACTATATTGAAAATCTAGGG - Intergenic
1189981472 X:46514989-46515011 CCTCAGAAATTGAAAGGATAAGG + Intronic
1194292940 X:92097664-92097686 ATACATATATTGAAATTCTATGG - Intronic
1194791561 X:98157423-98157445 CCTAATATACAGAAACTCTAAGG + Intergenic
1195020190 X:100819512-100819534 CCACATGTATTAAAAGTATATGG - Intergenic
1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG + Intergenic
1196489725 X:116251527-116251549 CCTAATATTTTAAAAGTTTAAGG + Intergenic
1198034255 X:132785111-132785133 TATCAAATATTGAAAGGCTAAGG - Intronic
1198300772 X:135332337-135332359 CTTCATATGTTGAAATCCTAAGG + Intronic
1199179536 X:144837084-144837106 CTTCATATATTGGAAGGCTCAGG + Intergenic
1200610446 Y:5322215-5322237 ATTCATATATTGAAATTCTATGG - Intronic