ID: 1060084716

View in Genome Browser
Species Human (GRCh38)
Location 9:120686710-120686732
Sequence GTGGACTAGAATCCAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060084711_1060084716 29 Left 1060084711 9:120686658-120686680 CCTTTTTACAGATAACTGAAGCT 0: 1
1: 1
2: 3
3: 57
4: 394
Right 1060084716 9:120686710-120686732 GTGGACTAGAATCCAAACACTGG No data
1060084715_1060084716 -6 Left 1060084715 9:120686693-120686715 CCAATCTTTAAAGTCAGGTGGAC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1060084716 9:120686710-120686732 GTGGACTAGAATCCAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060084716 Original CRISPR GTGGACTAGAATCCAAACAC TGG Intronic
No off target data available for this crispr