ID: 1060085811

View in Genome Browser
Species Human (GRCh38)
Location 9:120700284-120700306
Sequence TTCAACTTGTCCGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060085811_1060085813 16 Left 1060085811 9:120700284-120700306 CCTGCCTTTGCGGACAAGTTGAA 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1060085813 9:120700323-120700345 AAAACTAAAACCAGTTGAACAGG No data
1060085811_1060085816 29 Left 1060085811 9:120700284-120700306 CCTGCCTTTGCGGACAAGTTGAA 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1060085816 9:120700336-120700358 GTTGAACAGGATAGGTTTGCAGG No data
1060085811_1060085814 21 Left 1060085811 9:120700284-120700306 CCTGCCTTTGCGGACAAGTTGAA 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1060085814 9:120700328-120700350 TAAAACCAGTTGAACAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060085811 Original CRISPR TTCAACTTGTCCGCAAAGGC AGG (reversed) Intronic
903934306 1:26884414-26884436 TTCTACATGTCCCCAAAGGCTGG + Intronic
906931668 1:50176174-50176196 ATCAACTTGTCTGCAAAGAGAGG - Intronic
912729064 1:112085490-112085512 TTCCTCTTATCCGCAAAGGGTGG - Intergenic
915905660 1:159875096-159875118 TTGAACTTCTCCAAAAAGGCTGG + Intronic
916401305 1:164451894-164451916 TTCACCATGTTGGCAAAGGCTGG - Intergenic
920027348 1:203008843-203008865 TTCAATTTGTCACCACAGGCAGG - Intronic
1069678366 10:70266010-70266032 TTCAACTTCTCAGATAAGGCTGG - Intronic
1070151333 10:73807025-73807047 TTCAACTTGTCTGCCCAGGGAGG + Intronic
1073580741 10:104663471-104663493 TTCAACTTCTCCTCCAAGGCAGG + Intronic
1077513640 11:2987011-2987033 TTGAACTTGTGCCCAATGGCTGG - Intronic
1079995229 11:27288601-27288623 TTCAACTTTTCACCACAGGCAGG + Intergenic
1080892010 11:36417223-36417245 TTCCACTTGTGCGCAAAGCTTGG + Intronic
1092447040 12:8567556-8567578 TTCCACTTGTCTGCATAGGCAGG - Intergenic
1100117859 12:91330323-91330345 TTGGATTTCTCCGCAAAGGCTGG + Intergenic
1103832927 12:123794950-123794972 TTCACCATGTTGGCAAAGGCTGG - Intronic
1104352399 12:128056319-128056341 TTCAAGTTCTCCGCCAGGGCAGG + Intergenic
1118966984 14:70596102-70596124 TACAAATTGTCTGCAAAGGCTGG - Intronic
1119393229 14:74305663-74305685 TTAGACTTGTCCCCCAAGGCTGG + Intronic
1119729358 14:76941248-76941270 GTAATCTTGTCAGCAAAGGCAGG + Intergenic
1127589106 15:60405358-60405380 TTCAAGTTTTCCCCAAAGCCTGG - Intergenic
1128250568 15:66161088-66161110 TTCAACTTTTTCTCAAAGACTGG + Intronic
1134433861 16:14236934-14236956 TCCAACTTGTCCACAAATCCTGG - Intronic
1140922612 16:79552921-79552943 TTCAACTTGGCGGCAATAGCAGG + Intergenic
1144480026 17:15621523-15621545 TTCAACTTCCCCCCAAAGTCGGG - Intronic
1144918277 17:18742223-18742245 TTCAACTTCCCCCCAAAGTCAGG + Intergenic
1148334284 17:46831484-46831506 TTCCAGTTGTCCAGAAAGGCTGG + Intronic
1151510341 17:74555080-74555102 TTCAACCTGTCAGCACAGCCAGG + Intergenic
1151751297 17:76039767-76039789 TCCAACTTGTCCTCAAGGGGTGG + Exonic
1155055228 18:22176802-22176824 TTCTCCTTGGCCGCAAAGCCAGG - Intronic
1155648784 18:28115117-28115139 TTCAACCTGTCCTTAAAGCCTGG + Intronic
1156373263 18:36490123-36490145 TTCAACCTCTCCGCAGAGGGAGG + Intronic
1160421829 18:78753344-78753366 GTCCACTTGTCAGCAAACGCGGG + Intergenic
1163734450 19:18970690-18970712 TTCACCATGTCAGCCAAGGCTGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
931713463 2:65009617-65009639 TGCAGCTTGAGCGCAAAGGCTGG - Intronic
933293330 2:80461911-80461933 TGCAAGTTGTCAGCAAGGGCAGG + Intronic
933792059 2:85890723-85890745 TTCCCCTTGTCGGCAAAGCCAGG + Intergenic
934094156 2:88583533-88583555 TTCACCTTATCAGCAAAGGAAGG - Exonic
939329105 2:140735495-140735517 TTCAAATGTTCAGCAAAGGCAGG + Intronic
939600501 2:144183749-144183771 TTCAAGATGTCCGCACATGCAGG - Intronic
942837422 2:180316662-180316684 TTCATCTTGTCCCCAAAAGATGG + Intergenic
945418500 2:209604651-209604673 TTCAAATTGTACACATAGGCAGG + Intronic
1170096954 20:12656590-12656612 TTGAACTTATCTGCAAAGCCTGG + Intergenic
1174987430 20:55470672-55470694 TTCAACATGTCCACAAAGCATGG + Intergenic
1176518059 21:7801105-7801127 TTGAACTTGACTCCAAAGGCAGG - Intergenic
1178652087 21:34431118-34431140 TTGAACTTGACTCCAAAGGCAGG - Intergenic
1179288367 21:39997160-39997182 TTCACCTTGTAGGCAAAGGAGGG - Intergenic
1179719724 21:43308250-43308272 CTCATCTTATCCGCAAAGGGTGG - Intergenic
1183035780 22:35140068-35140090 TTCAAACTGACCCCAAAGGCTGG + Intergenic
1184545203 22:45163145-45163167 TTTAACTTGTTCGCCCAGGCTGG - Intergenic
950158201 3:10739593-10739615 TCCTACTTGGCCACAAAGGCAGG + Intergenic
960938415 3:122917602-122917624 TTCTCCTTGTCAGCAAAGGAGGG + Intronic
961996950 3:131256029-131256051 TTAAATTTGTCTCCAAAGGCTGG + Intronic
963966715 3:151380157-151380179 TTCATCTTGTCCCTTAAGGCAGG - Exonic
970055344 4:11965161-11965183 TTCAGCTTGGCCCTAAAGGCAGG + Intergenic
975601453 4:76104287-76104309 GTCAACTTGTGCGTAAAGGTAGG - Intronic
977900460 4:102416303-102416325 TCCATCCTGTCAGCAAAGGCAGG + Intronic
993617543 5:90132188-90132210 TTCAACTTGTCACCAGAAGCAGG - Intergenic
1000255021 5:159529380-159529402 TTCAACTCGTCATCAAAGGATGG - Intergenic
1000870515 5:166571250-166571272 TTCAACTGGGCCGGCAAGGCTGG - Intergenic
1020242076 7:6403056-6403078 TTCAAAATCTCCGCAAAAGCTGG - Intronic
1021299935 7:18960093-18960115 TTCAAATTGTCCTCAAAAGTTGG - Intronic
1022241008 7:28512446-28512468 TTCAACATGTCTGCTAGGGCTGG - Intronic
1036131964 8:6123837-6123859 TTCAACGTGTCAGCAAAGGCAGG + Intergenic
1036212231 8:6851963-6851985 TTCCACTTGGCCCCAAAGGTTGG - Intergenic
1037520862 8:19679632-19679654 TTCAACCTGTGCACAAAGGAAGG + Intronic
1039822046 8:41142937-41142959 TTGACCTTGGCCTCAAAGGCAGG + Intergenic
1041690701 8:60684174-60684196 CTTAACTTGTCAGTAAAGGCTGG + Intronic
1046042696 8:108925871-108925893 TATATCTTGTCCACAAAGGCAGG + Intergenic
1047128969 8:121996740-121996762 CTCAACTTTTCAGCAAAGTCTGG - Intergenic
1049907235 9:229555-229577 TGCCACATGTCCCCAAAGGCAGG + Intronic
1055050979 9:71980506-71980528 TACAACATGTCCGCAAAGTCAGG + Intronic
1056571513 9:87820793-87820815 TTCAGCTTGTCACCAAAGGCTGG + Intergenic
1060085811 9:120700284-120700306 TTCAACTTGTCCGCAAAGGCAGG - Intronic
1188956992 X:36444860-36444882 TACAAATTGCCCGCAAAGGGTGG - Intergenic
1195506927 X:105668599-105668621 CTCAACTTGTCTTCAAATGCTGG - Intronic