ID: 1060088283

View in Genome Browser
Species Human (GRCh38)
Location 9:120720974-120720996
Sequence CTGGAAGGGCAAAATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060088274_1060088283 28 Left 1060088274 9:120720923-120720945 CCAGGAACATGCAGTGGCTGTCT 0: 1
1: 0
2: 1
3: 24
4: 176
Right 1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 368
1060088273_1060088283 29 Left 1060088273 9:120720922-120720944 CCCAGGAACATGCAGTGGCTGTC 0: 1
1: 0
2: 4
3: 16
4: 170
Right 1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 368
1060088277_1060088283 2 Left 1060088277 9:120720949-120720971 CCGAGGCTGGCATGCCAGTGTTC 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060088283 Original CRISPR CTGGAAGGGCAAAATGAAAG AGG Intergenic
900728347 1:4233763-4233785 CTGGAAAAGCAAAATGAAATTGG - Intergenic
903240317 1:21978383-21978405 CTGGAAGGGCGAGAGGAAGGTGG - Exonic
903931051 1:26862819-26862841 CTGGAAGGGCACTGTGAAAGTGG + Intergenic
905357874 1:37397285-37397307 CTGGGAGAGAAAAATGGAAGTGG - Intergenic
906184834 1:43853995-43854017 CTGGAAGGGCAGAGAGAGAGGGG - Intronic
906534243 1:46543022-46543044 CTGCAAGAGCAAAATCAAGGTGG - Intergenic
907381193 1:54091716-54091738 CTGGAAGGGAGAAAGTAAAGGGG - Intronic
907580776 1:55570632-55570654 CTGGAAGGGAAAGAGGAAAAAGG + Intergenic
907701474 1:56792286-56792308 CTGGAAGGGCAAAAAGGCATGGG - Exonic
908086200 1:60636748-60636770 TTGGAAGGACAAAAGGAAACAGG + Intergenic
908535192 1:65069824-65069846 CTGGATGGGGTAAATGAAATTGG + Intergenic
909150712 1:72000811-72000833 CTAGATAGTCAAAATGAAAGAGG + Intronic
909701761 1:78532256-78532278 ATGGAGAGGCAACATGAAAGTGG + Intronic
909728367 1:78863937-78863959 CTCGCAGGGCCAAATGGAAGGGG + Intergenic
910117024 1:83742778-83742800 CTGAGAGGGCAACATGAAAAAGG + Intergenic
910184747 1:84526085-84526107 CTGGAATGGGAAAAAGAAAGAGG + Intergenic
912240875 1:107906822-107906844 AAGGAAGTGTAAAATGAAAGAGG + Intronic
913223679 1:116679844-116679866 CTGGAAGAGAAAGATGGAAGAGG - Intergenic
914864388 1:151414290-151414312 CTAGAAGAGAAAAATGAGAGAGG - Intronic
916086649 1:161275094-161275116 CTGGCAGGGCAGAGGGAAAGTGG + Intronic
916160289 1:161905138-161905160 CTGGAAGGGGAGAAAAAAAGGGG - Intronic
916476264 1:165172100-165172122 TTTGAATGGGAAAATGAAAGGGG - Intergenic
917877025 1:179295174-179295196 CTGGAAAGCCAGAAGGAAAGTGG - Intronic
918040516 1:180911825-180911847 CTGGCAGGGCAACAGGAGAGCGG - Intergenic
921320973 1:213938232-213938254 CTGGAAAGGGAAAAGAAAAGAGG + Intergenic
921933211 1:220772352-220772374 CAGGAAGAGCACAATGAAAAGGG - Intronic
924022677 1:239800929-239800951 CTGGAAGTGTAACTTGAAAGGGG - Intronic
924507498 1:244699636-244699658 CTGGAAGGGATATATTAAAGCGG - Intronic
1062881800 10:985008-985030 CTGGCAGTGCAAAAGGAGAGTGG + Intergenic
1064480929 10:15739840-15739862 CTTCAAGGGCAACATCAAAGAGG + Intergenic
1064731377 10:18334402-18334424 CTGGAGAGGCAAAATGCAGGAGG - Intronic
1064932491 10:20642818-20642840 CTGGAAGGGAATAAAGGAAGCGG + Intergenic
1065178748 10:23104360-23104382 CGAGAAGGGCACAATGGAAGAGG - Intronic
1065685239 10:28277818-28277840 CTGAAAGTGAAAAATTAAAGAGG + Intronic
1066497880 10:35959882-35959904 GAGGAAGGGAAAAAGGAAAGAGG - Intergenic
1067352635 10:45490489-45490511 CTGGAAGTCCAAGATGAAGGTGG - Intronic
1068018925 10:51555964-51555986 CAGGAAGGGAGAAAAGAAAGGGG + Intronic
1068521896 10:58085969-58085991 GTGGAAGGTCAAAAGGAAGGAGG - Intergenic
1068731000 10:60357740-60357762 CTGGAAGTGAAAAATGAAGAGGG - Intronic
1068779580 10:60905092-60905114 CTTCAAGTGCAAAATGTAAGAGG + Intronic
1070067362 10:73050256-73050278 CTGGAAGGATCAAATGAAAAAGG + Intronic
1070781583 10:79140596-79140618 GTGGAAGGACTAAAAGAAAGAGG - Intronic
1071025850 10:81112187-81112209 CAGGAAAGAAAAAATGAAAGAGG - Intergenic
1071265655 10:83962609-83962631 GGGGAAGTGCAAGATGAAAGTGG - Intergenic
1071527233 10:86365905-86365927 TTGGCAGGGCAAGATCAAAGAGG - Intronic
1072106493 10:92279465-92279487 CTGTGAAGGAAAAATGAAAGTGG - Intronic
1072692954 10:97583669-97583691 CTGGAGGGGCCTAATGATAGTGG + Exonic
1073072447 10:100803281-100803303 GTGGAAGGGCAGAAAGAAGGAGG - Intronic
1073223196 10:101893696-101893718 AGGGAAGGGGAAAAGGAAAGAGG + Intronic
1074075654 10:110121546-110121568 TTGGAAGGGCCACAAGAAAGGGG + Intronic
1075267910 10:121020818-121020840 CTGGAAAGGCAAAGCCAAAGGGG + Intergenic
1075288437 10:121207450-121207472 CTGGAAGGGAAAGATGAATGGGG - Intergenic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1079275059 11:19027958-19027980 ATGCAAGGCCAAAATGAGAGAGG - Intergenic
1079301720 11:19284505-19284527 AAGGAAGGGGAAGATGAAAGAGG - Intergenic
1079692593 11:23438508-23438530 CTGAAAGACCAAAAGGAAAGTGG + Intergenic
1079816059 11:25059919-25059941 AAGGAAGGGAAAAATGAAAAAGG + Intronic
1080802944 11:35625487-35625509 CTGGAAAGGCAAAGTGACTGGGG + Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081037786 11:38170981-38171003 CTAGGAGTGGAAAATGAAAGTGG + Intergenic
1081397292 11:42601741-42601763 CTGGTAGGAGAAAAGGAAAGGGG - Intergenic
1081398365 11:42613936-42613958 GTGGAGGGGCAAAATGTAATAGG - Intergenic
1081726683 11:45334666-45334688 CTGGCAGGGCAAAATAGATGAGG + Intergenic
1084162414 11:67356949-67356971 CTGGATGGCCAAGGTGAAAGAGG - Intronic
1085143288 11:74169962-74169984 CTCGAAGGGAAAAAGGACAGTGG - Intronic
1085398966 11:76224215-76224237 CTTAAAAGGCAAAATGAAACAGG - Intergenic
1086932944 11:92712893-92712915 CTGGAAGGACAGAATGCATGAGG + Intronic
1087252248 11:95915924-95915946 CTGGAACCATAAAATGAAAGTGG - Intronic
1088358482 11:108967461-108967483 CTGAAAGGGCAAATTTGAAGTGG + Intergenic
1088755641 11:112883067-112883089 CTGGATGGTCTACATGAAAGTGG + Intergenic
1088840835 11:113626426-113626448 CTAGAAGGCCAAAATCAAGGAGG + Intergenic
1088923004 11:114275286-114275308 CTGGAAGGGAAAGATGATGGAGG + Intronic
1090007043 11:123011858-123011880 CTGGAAGATCACAAAGAAAGAGG + Intergenic
1090464763 11:126924248-126924270 CTAGAAGGGAAAACTGAAGGTGG - Intronic
1091523276 12:1269813-1269835 CGTGAAGGGGAAAATGAAAAAGG - Intronic
1091659635 12:2373748-2373770 ATGGAAAGGCAAAAGGAAAATGG - Intronic
1094094493 12:26688501-26688523 AGGGAAGGGGAAAAAGAAAGGGG + Intronic
1094314144 12:29119346-29119368 CTGGAAGGGAAAAATCTAATTGG + Intergenic
1095328657 12:40930104-40930126 CAGGAAGGACAATATAAAAGGGG + Intronic
1096262563 12:50102293-50102315 TTGTAGGGGCAAAATGAGAGAGG + Intergenic
1096411841 12:51382700-51382722 CAGGAAGAGCAATATGACAGCGG + Intronic
1099855073 12:88154265-88154287 CTAGAAAGGAAAAATGAAGGGGG - Intronic
1101270498 12:103138743-103138765 TTGGAAGGGTCAAAGGAAAGAGG - Intergenic
1102341781 12:112127078-112127100 CTGGAAGAGCATAATAAAAAAGG - Intronic
1102621999 12:114203481-114203503 CTGGAAAGCAAAAATGAGAGTGG - Intergenic
1102644203 12:114393336-114393358 CTGGAAGGGCAAAGTGGGAGGGG - Intronic
1104475718 12:129068900-129068922 CTGCAAGGGCAAAACAAAGGGGG + Intergenic
1105392203 13:19990912-19990934 CTTGGGGGGCAAAATGCAAGGGG - Intronic
1105716147 13:23066941-23066963 CTGGAAGACCACTATGAAAGAGG + Intergenic
1106489926 13:30211768-30211790 CTGGAAGAGCAACAGCAAAGTGG + Intronic
1106608324 13:31252534-31252556 ATGGAAGGCCAAAAAAAAAGCGG + Intronic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1107948817 13:45443911-45443933 ATGGAAGGGCAAAAAGAATTAGG - Intergenic
1108333024 13:49409414-49409436 CTTGAAGGGCTTAATAAAAGAGG + Intronic
1108818925 13:54321847-54321869 CTGTAAGGCCAGGATGAAAGAGG - Intergenic
1108838240 13:54578723-54578745 CTGGAATGGTAAAAATAAAGGGG - Intergenic
1109568579 13:64153944-64153966 CAGGAAGGGTAAAAAGAAGGAGG - Intergenic
1110419147 13:75285619-75285641 TTGGAAGGGAAAAAAGAAAGTGG - Exonic
1110913872 13:80997901-80997923 GTAGAAGGTCAAAAGGAAAGTGG - Intergenic
1110965264 13:81686866-81686888 ATGTAAGGGCAAAATTAAAATGG - Intergenic
1111076789 13:83248008-83248030 AAGGAAGGGGAAAATGACAGTGG - Intergenic
1111505014 13:89176835-89176857 CTGGCAAGACAAACTGAAAGTGG - Intergenic
1112381333 13:98893548-98893570 TTGCAAGGGAAAAAGGAAAGTGG + Intronic
1113869711 13:113551761-113551783 CTGGAAGGTCTGGATGAAAGAGG - Intronic
1115548934 14:34488005-34488027 CTGGAAGGGCAAGAGGAGACAGG - Intergenic
1116216844 14:42027510-42027532 CAGGAAAGGGAAAATTAAAGTGG - Intergenic
1117094543 14:52283876-52283898 CTGGAAGGGGAAAATGACCCTGG - Intergenic
1118078603 14:62330565-62330587 CAGGGAAGGCAAAATGAAGGAGG + Intergenic
1118313530 14:64709599-64709621 CTGGAAGGGAAAGATGCAGGAGG + Intronic
1118533910 14:66737233-66737255 AGGGAAGGGGAAAAAGAAAGAGG - Intronic
1119184730 14:72632042-72632064 CTTGATGAGCAAAAGGAAAGGGG + Intronic
1119314378 14:73679516-73679538 GGGGAAGGGCAGAAGGAAAGGGG + Intronic
1120921806 14:89762129-89762151 TTGGAAGGGAGAAGTGAAAGTGG - Intergenic
1121049619 14:90811984-90812006 CTGGCAGGGAAAAAAGAGAGTGG - Intronic
1122014377 14:98781633-98781655 CTGCAAGGTGAAAAGGAAAGAGG - Intergenic
1123826510 15:24087508-24087530 CTGGAAAATCAAAATGCAAGGGG - Intergenic
1124179542 15:27459415-27459437 CCGTAAAGGCAAAATGAAACTGG + Intronic
1125098538 15:35882788-35882810 CTGGAAGGGAAATGTCAAAGGGG - Intergenic
1125827327 15:42687492-42687514 TGGGAAGGGAAAAATGAAACTGG + Exonic
1126358510 15:47821706-47821728 AAGGAAGGGCAAAATGCAAGTGG - Intergenic
1126407969 15:48341955-48341977 CTGGAGAGGAAAACTGAAAGAGG + Intronic
1126819949 15:52492766-52492788 ATGGAAAGGCAAAATGAGTGAGG + Intronic
1130151377 15:81314327-81314349 CTGGAAGTCCAGAATCAAAGGGG + Intronic
1131322437 15:91407441-91407463 CTGGAAGGGAAGGAGGAAAGCGG + Intergenic
1131352073 15:91710092-91710114 CTCTAAGGTCAAAATCAAAGTGG + Intergenic
1131374445 15:91912073-91912095 CTGCAAGAGGAAAAGGAAAGAGG - Intronic
1134046029 16:11101735-11101757 CATGAAGGGCAAAATAAAAAAGG - Intronic
1134196982 16:12166791-12166813 CTGGAAGCACTGAATGAAAGTGG - Intronic
1136083511 16:27868210-27868232 CGGGAAGGGGAAAATGACAGGGG + Intronic
1136146324 16:28318716-28318738 CGGGCAGGACAAAATGAGAGAGG + Intronic
1139284017 16:65794738-65794760 CTGGATGAGAAAAATCAAAGAGG - Intergenic
1139759139 16:69170251-69170273 CTGGAAAGGGAAAATAAATGAGG + Intronic
1140034603 16:71362773-71362795 GTGGATGAGCCAAATGAAAGGGG + Intronic
1141891399 16:86929025-86929047 CTGAAAGGACAAAGTGACAGAGG + Intergenic
1142324666 16:89406840-89406862 ATGGAAGGGGAAAAGGAAAAGGG + Intronic
1142579662 17:933649-933671 GTGGGAGGCCAAGATGAAAGGGG - Intronic
1144142085 17:12359445-12359467 CTGGCAGAGGAAAAGGAAAGGGG - Intergenic
1144735949 17:17555579-17555601 CTGGAGGGGCCAAAGGAAAAGGG - Intronic
1144864021 17:18323458-18323480 CTTGAGTGGCAAAATGAACGAGG + Intergenic
1148317085 17:46711113-46711135 CTGGAAGGTGAGAATGAATGAGG + Exonic
1149878870 17:60267455-60267477 CTGGAAAGGTAACATGGAAGTGG - Intronic
1150577672 17:66444535-66444557 CTGGAAGGTCATAAAGAAGGAGG - Intronic
1151235157 17:72714595-72714617 CCTGAAGGGGTAAATGAAAGTGG - Intronic
1151463983 17:74272819-74272841 CTGCAGGGGAAAAATGAGAGAGG - Intergenic
1152003575 17:77662697-77662719 CTGGAAGTTCAAGATGAAGGTGG - Intergenic
1153317941 18:3742513-3742535 CTGGAAGGGAACAATGGAAGAGG + Intronic
1154490355 18:14917391-14917413 CAGGAAGGGAAAGATGGAAGAGG - Intergenic
1155216671 18:23649194-23649216 CTGCAAGAACAAAATGAAACAGG + Intronic
1156710263 18:39935793-39935815 CTGGAAGGCCAAGAGGAAGGAGG + Intergenic
1156820511 18:41366746-41366768 CTAGAAGGACACAAAGAAAGAGG - Intergenic
1157177509 18:45464995-45465017 AGGGAAGGGCACAAGGAAAGGGG + Intronic
1158562736 18:58528903-58528925 CTGGATGGGGAAAATGATGGAGG - Intronic
1158963986 18:62607880-62607902 CTGGAAGTCCAAAATCAAGGTGG + Intergenic
1159591358 18:70338742-70338764 CTGGGGGTGCAAAAAGAAAGTGG + Intronic
1159871909 18:73767957-73767979 TTCTAAAGGCAAAATGAAAGTGG + Intergenic
1160244509 18:77146333-77146355 CTTGAAGGGAAAGAGGAAAGTGG + Intergenic
1161705083 19:5816278-5816300 TTGGAGGGGCCAAAGGAAAGGGG - Intergenic
1161747450 19:6069867-6069889 CTGGAAGAGGAAACTGAGAGCGG + Intronic
1162247312 19:9412637-9412659 CTGGAAGTGCAATATCAAGGTGG + Exonic
1162910384 19:13844707-13844729 CTGGAGGGGCAATATGGATGGGG - Intergenic
1163321071 19:16575243-16575265 CAGGAAGGGAAAAAAGAAAAGGG + Exonic
1165565438 19:36723282-36723304 CTGGAAATGCAAAATCAAAGGGG - Intronic
1168554376 19:57325903-57325925 CAGGAAGGGCTAAATGAGGGAGG - Intronic
925398009 2:3550659-3550681 CTGCAAGATCAAAATGTAAGTGG - Intronic
926008395 2:9390124-9390146 CAGGAACGGCAAAAAGAAAAAGG - Intronic
926769979 2:16362491-16362513 CTGTGAGGGCTAAATGAAATTGG - Intergenic
927108161 2:19845184-19845206 GTTGAAGAGCAAAAAGAAAGAGG + Intergenic
927566095 2:24114423-24114445 CTGGAAGGGTCAGATGTAAGAGG + Intronic
927608604 2:24513259-24513281 GTGGAAGGGGTAAAAGAAAGAGG - Intronic
927814396 2:26201650-26201672 CTAGAATGGCAAAACAAAAGAGG + Intronic
928086179 2:28347803-28347825 CTGGAAGAGGCAAGTGAAAGCGG + Intergenic
928245131 2:29620214-29620236 CTGGAAGTCCAAAATCAAGGTGG + Intronic
928329747 2:30348547-30348569 TTGGAAGGTCAAAAGGAAAGAGG - Intergenic
928955123 2:36858277-36858299 ATGGAAGGACAAAAGGAAGGGGG - Intronic
929305799 2:40360173-40360195 GTGGAGGGGCAAAATAAAAATGG - Intronic
929694663 2:44104004-44104026 CAGGGAGGGGAAAATGAAAGGGG - Intergenic
930288529 2:49465362-49465384 GTGGAAGGGCAGAGGGAAAGGGG - Intergenic
931121108 2:59221005-59221027 TTGGAAGGGATAAATCAAAGTGG + Intergenic
931871341 2:66463734-66463756 CTGGAAATGCAAAATGAGAGTGG - Intronic
935171014 2:100611629-100611651 CTGGCAGGGCAGAATGAAGCTGG + Intergenic
938367364 2:130745249-130745271 ATGCAAGGGCAAAAGGAAACTGG + Intergenic
938597122 2:132799246-132799268 CTAGATGGGGAAAAAGAAAGGGG + Intronic
938939783 2:136159754-136159776 CTGGATAGGAAAAATGGAAGGGG + Intergenic
939438264 2:142206717-142206739 CTCCAAGTGCAAAGTGAAAGAGG - Intergenic
939570138 2:143831303-143831325 CTGGCAGGGCCTAAGGAAAGAGG + Intergenic
940731328 2:157396166-157396188 CTGGTCTGGGAAAATGAAAGAGG + Intergenic
940913272 2:159227815-159227837 CTAGAAAGGGAAAATGAAAGAGG + Exonic
941140817 2:161779098-161779120 GTGGAAGGTCAAAGTGGAAGTGG + Intronic
941600044 2:167531294-167531316 TTGGCAGGGGAAAAGGAAAGGGG + Intergenic
941936458 2:170985191-170985213 CTGGCACTGCAAAATAAAAGTGG - Intergenic
943296958 2:186153180-186153202 CTGGAAGGTCAAAATATAAAAGG + Intergenic
945266067 2:207892659-207892681 ATGGAATGGGATAATGAAAGGGG - Intronic
945543526 2:211120320-211120342 CTGTGAGGAGAAAATGAAAGGGG + Intergenic
945660638 2:212681335-212681357 TTGGAGGGGCAAAATGATGGAGG + Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
947180362 2:227405854-227405876 GTGGATGGGCAACATCAAAGAGG + Intergenic
1169654051 20:7903002-7903024 CTGAAAAAGGAAAATGAAAGAGG + Intronic
1169753203 20:9016249-9016271 CTGGCACTGGAAAATGAAAGTGG + Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1171437786 20:25136511-25136533 GTGGAAGGGCAAAAGGAGGGAGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173130740 20:40390888-40390910 CTGGGAGGGCAGAAGGAAAGTGG - Intergenic
1173406917 20:42774383-42774405 CTGAAAGGGGACACTGAAAGGGG + Intronic
1174409849 20:50328119-50328141 CTGGAAGAGCACACTGAAAGAGG + Intergenic
1174462065 20:50690221-50690243 CTGCAAAGGCAAAATAAAATTGG + Intronic
1175533954 20:59694424-59694446 CTGTAAGTATAAAATGAAAGAGG + Intronic
1175743754 20:61439018-61439040 CTTGGGGGGAAAAATGAAAGAGG - Intronic
1175779028 20:61670669-61670691 CAGGAAAAGCAAAATCAAAGTGG + Intronic
1176361069 21:5997026-5997048 CTGAAAGGGTAAAATAAAACAGG - Intergenic
1177864321 21:26495010-26495032 CAGGACAGGCAAAAGGAAAGAGG + Intronic
1178722952 21:35026459-35026481 CTGTAATGCCAAAATGAAAAGGG - Intronic
1178918270 21:36721789-36721811 CAGGCAGGGTAAAATGAAACCGG - Intronic
1178952115 21:36993680-36993702 CTAGAAGTTCAAAATTAAAGTGG - Intergenic
1179351239 21:40612904-40612926 CTGGAAAGAAAAAATGAAGGAGG - Intronic
1179762449 21:43541524-43541546 CTGAAAGGGTAAAATAAAACAGG + Intronic
1181834430 22:25591238-25591260 CAGGAATAGCAAAATGGAAGAGG + Intronic
1182940590 22:34272765-34272787 TTGGTAGGACAAAGTGAAAGAGG + Intergenic
1182979527 22:34655440-34655462 CTGTAAGGCCAAGATGAAAGTGG + Intergenic
1184075194 22:42172580-42172602 CTTGAAGAGGGAAATGAAAGTGG - Intronic
1184302231 22:43568466-43568488 CTGGAGGGACCAAATGAATGGGG + Intronic
1184598978 22:45531685-45531707 CTGGAAGGGGAAAGGGAAGGAGG - Intronic
949340911 3:3029950-3029972 TTGGAATGGGAAAATGAAGGAGG + Intronic
949753620 3:7383335-7383357 CTGAAAGGAGATAATGAAAGTGG + Intronic
949769849 3:7567882-7567904 CTGGAACTGGAAAATGAATGCGG - Intronic
949935956 3:9116076-9116098 ATGGATGATCAAAATGAAAGGGG - Intronic
950011128 3:9724639-9724661 ATAGAAAGGCTAAATGAAAGAGG - Intronic
950048861 3:9970662-9970684 CTGGCAAAGCAAAATGAAAATGG + Intronic
950361362 3:12451725-12451747 CTGGAAGGCCAAGATCAAGGTGG - Intergenic
951134723 3:19091763-19091785 CAGCAAGGGAAAAATGAAAAAGG + Intergenic
952489381 3:33851796-33851818 CTGGGAGAGGAAAAGGAAAGAGG - Intronic
953891153 3:46752523-46752545 CTAGAAGGGCAAAGGGCAAGAGG + Intronic
954244587 3:49320806-49320828 ATGGAAGGCAAAAATGAAGGGGG - Intronic
955277603 3:57561878-57561900 CTCCAAGGGGAAAATTAAAGTGG + Exonic
955470169 3:59278526-59278548 GAGGAAGGGCAAAATGAAAGAGG - Intergenic
955750853 3:62184431-62184453 TTTGAAGGGCTATATGAAAGAGG - Intronic
955841473 3:63117325-63117347 TAGGAAGGGAAAAATGAAATAGG - Intergenic
955844787 3:63150926-63150948 TTGGGAGGGCATAGTGAAAGAGG + Intergenic
957996567 3:87697643-87697665 ATGAAAAGGAAAAATGAAAGAGG + Intergenic
959490517 3:106982299-106982321 CAGGCAGAGCAAAATGAAACTGG - Intergenic
960847335 3:122016723-122016745 ATGGAAGATTAAAATGAAAGTGG + Intronic
961017572 3:123479552-123479574 CTGTCAGGGCAGAATGCAAGCGG + Intergenic
961613723 3:128162179-128162201 CTGGATGGGCACAAAGAAACAGG - Intronic
962224595 3:133595324-133595346 ATGAAAGGGCAAATTTAAAGTGG - Intergenic
962300077 3:134231950-134231972 ATTGAAGGGCAGATTGAAAGTGG - Intronic
962720685 3:138171948-138171970 CTGGAAGGGACAAATGAGATAGG + Intronic
963306226 3:143656468-143656490 CTGAAAGGGCATCAAGAAAGTGG - Intronic
964073035 3:152658341-152658363 CTGGCAGTGCAAAATGCAGGGGG - Intergenic
965261145 3:166487741-166487763 TAGGAAGGGTAAAATGAAAAGGG - Intergenic
966622825 3:181984219-181984241 CTGGATGAACAAAAAGAAAGAGG + Intergenic
966748895 3:183303563-183303585 CTGGGAGGGTAAGAGGAAAGGGG - Intronic
967523998 3:190471092-190471114 CTTGAATGAAAAAATGAAAGAGG - Intergenic
968265987 3:197363813-197363835 CTGGAAGAGCAGAATCAAAGTGG + Intergenic
969213017 4:5702047-5702069 CTGGAAAGGAAACATGAGAGTGG + Intronic
969832291 4:9807547-9807569 CTGGAAATGCAAAAGGCAAGAGG - Intronic
972145286 4:36016963-36016985 GTGAAAGGGCAGAATGAATGTGG - Intronic
974729476 4:65843320-65843342 CTAGAAGGCCAAAATATAAGGGG - Intergenic
975914105 4:79302422-79302444 ATGGTAGGACAAAATGAAAAGGG + Intronic
975934677 4:79564352-79564374 CTGGAAGGGCAAAGAGAAGAAGG + Intergenic
979211501 4:118109812-118109834 CTTGAAGGGAAAAAGAAAAGTGG + Intronic
981135363 4:141205436-141205458 TTGGAAAGGCAAAATTAGAGAGG + Intronic
981415883 4:144492872-144492894 CTGGAAGGCTAAACTAAAAGTGG + Intergenic
981458576 4:144985257-144985279 CTGGAAGGCCAAAATAATATGGG + Intronic
982504578 4:156200307-156200329 CTTGAAGAGTAAAATGAAAGAGG + Intergenic
982573829 4:157082804-157082826 CTTGAAGGGCTAAATGAGATAGG + Intronic
982804652 4:159748771-159748793 ATGAAAAGGCAACATGAAAGAGG - Intergenic
985575491 5:671732-671754 CTGGCAGGGCAGGATGAACGTGG - Intronic
985820278 5:2155270-2155292 ATGGAATGACAAAATGAATGGGG + Intergenic
985839405 5:2294940-2294962 CTGGAAAGGTAACATGAGAGGGG - Intergenic
986969536 5:13315936-13315958 CTGGAATGGAAAAACCAAAGGGG - Intergenic
987270629 5:16304752-16304774 GAGGGAGGGCAAAATGAAACGGG + Intergenic
987705128 5:21453371-21453393 CTGGAAGTTCAAAATTAAGGTGG + Intergenic
988074912 5:26339779-26339801 CTGGAAAGAGAGAATGAAAGAGG + Intergenic
988275652 5:29078362-29078384 CTGGAAGGGAAAAATGATCAAGG + Intergenic
988300798 5:29423824-29423846 CTGGAAGTTCAAAATTAAGGTGG - Intergenic
991474290 5:67003734-67003756 TTGAAAGGGCAGAATGAAGGGGG - Intronic
992588985 5:78273558-78273580 CTTGAAGGACAAAATTACAGAGG + Intronic
992831956 5:80602033-80602055 CTTGCAGAGAAAAATGAAAGCGG + Intergenic
992892187 5:81213627-81213649 CTTGGAGGGCAAAATGAAGATGG - Intronic
993711548 5:91230282-91230304 CTGCTAGGGCAATGTGAAAGGGG - Intergenic
993892363 5:93489938-93489960 CTGAAAAAGGAAAATGAAAGAGG + Intergenic
995410392 5:111850765-111850787 CTTGAAGGGAAAAAGAAAAGTGG - Intronic
996356618 5:122602298-122602320 CTGTAGGGCCAAAATGAATGTGG - Intergenic
996700499 5:126445896-126445918 CAGGAAGGGCAAGAGAAAAGGGG + Intronic
997628660 5:135349424-135349446 CTGCCAGGCCAAAATGAAATCGG - Intronic
997868857 5:137489290-137489312 GTGGAAGGGGAAAAGGTAAGGGG + Intronic
997949827 5:138233482-138233504 CTGGAAGACCAAAATCAAGGTGG + Intergenic
999085091 5:148880964-148880986 CTGGAAAGGCAAGGAGAAAGAGG + Intergenic
999333432 5:150694252-150694274 CAGGCAGAGAAAAATGAAAGTGG + Intronic
999871126 5:155752536-155752558 CTGGAAGGGCAACAAAAGAGTGG - Intergenic
1002083095 5:176749016-176749038 CTGGAAGAGAAAAAAGGAAGGGG - Intergenic
1003896622 6:10614296-10614318 ATTGAAGGGCAAATTGAAATGGG + Intronic
1005468670 6:26140614-26140636 GTGGAAGGAAAGAATGAAAGAGG + Intergenic
1005758360 6:28945783-28945805 CTGGAAGAACAAAAAGGAAGAGG - Intergenic
1006000044 6:30957357-30957379 TTGGAAGGGGAAGATGAAGGTGG - Intergenic
1008526798 6:52415483-52415505 GTGAAAGGGGAAAAGGAAAGTGG + Intergenic
1009026378 6:58005264-58005286 CAGAAAGGGAAAAAGGAAAGAGG + Intergenic
1009201928 6:60756737-60756759 CAGAAAGGGAAAAAGGAAAGAGG + Intergenic
1009307741 6:62112316-62112338 ATGGAAGAGCCAAATTAAAGCGG + Intronic
1009445625 6:63739044-63739066 GAGGCAGGGAAAAATGAAAGAGG - Intronic
1011883436 6:92060067-92060089 CAGGAAGGGAAAAATGGGAGGGG + Intergenic
1012424181 6:99096042-99096064 CTGGGAGAGGAAGATGAAAGGGG + Intergenic
1013357747 6:109361567-109361589 ATGGAAGGAGAAAATGAAAATGG - Intergenic
1014486707 6:122008130-122008152 GAGGAAGGGGAGAATGAAAGAGG + Intergenic
1015798741 6:137039416-137039438 CTTGAAGGGCAATAGGAGAGAGG + Intronic
1016234841 6:141851905-141851927 TTGAAAGGGCATAATGAAATGGG - Intergenic
1016525519 6:144997840-144997862 CTGGAAGGGAAACTAGAAAGCGG - Intergenic
1016589705 6:145730832-145730854 CTAGAAAAGCAACATGAAAGAGG + Intronic
1016710349 6:147164333-147164355 CGGGAAGGTCAAAAAGGAAGTGG + Intergenic
1016789325 6:148051503-148051525 CTGGTAAATCAAAATGAAAGAGG + Intergenic
1017966500 6:159271304-159271326 CTGGAAGGGCAACAGGAGAGGGG - Intronic
1018378289 6:163233817-163233839 CTGGAAGGGGAAATGGAATGAGG + Intronic
1018469825 6:164085464-164085486 CTGGAAGGAGAGAAAGAAAGAGG + Intergenic
1019429143 7:990773-990795 CTTGAAGGGCAGAAAGAACGGGG + Intergenic
1020408713 7:7866467-7866489 CTGGAAGGGCAAATTGAAATAGG + Intronic
1022657642 7:32335034-32335056 ATGCATGGGCAAAATGAAAGTGG - Intergenic
1022831328 7:34070054-34070076 CAGAAAGGGCACCATGAAAGTGG - Intronic
1023053952 7:36276946-36276968 CAGAAAGGTCAAAATGGAAGAGG - Intronic
1023364157 7:39446288-39446310 CTGCAAAGGCAAAATGAAGGAGG - Intronic
1023531970 7:41167099-41167121 ATGGGAGGACAAAATGGAAGGGG + Intergenic
1023814806 7:43941481-43941503 CTGGAAGGGAAGCATGAGAGGGG + Intronic
1024237068 7:47406879-47406901 AAGGAAGGGCAAAGTGAAGGCGG + Intronic
1024489756 7:49966950-49966972 GAGGAAGGATAAAATGAAAGAGG + Intronic
1025824186 7:64997519-64997541 CTGCAAGGGCTAAAGGAAGGTGG - Intronic
1026931284 7:74224256-74224278 CTGGAAGGGCAGGCTGAAAGTGG + Intronic
1029185229 7:98733566-98733588 CTGGAAGGGAGAAAAGAAATGGG + Intergenic
1031531579 7:122883617-122883639 CTCTTAGGGCAAAATGAAATGGG - Intronic
1032337541 7:131040085-131040107 CTAGAAGCTCAAAATAAAAGGGG + Intergenic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1034363130 7:150520011-150520033 CTGGTAGGGAAAACTGGAAGTGG + Exonic
1034719480 7:153276616-153276638 ATGGAACGACAAATTGAAAGTGG + Intergenic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1036711166 8:11079550-11079572 CTGGAAGGGGAAAAAGGAAATGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1038165909 8:25084933-25084955 CTGGAAGGGCAAGAAGACAGAGG + Intergenic
1038661580 8:29501985-29502007 CAGGAAGACCAGAATGAAAGGGG + Intergenic
1041196333 8:55405256-55405278 CTGGATGGGCAAGCTGAGAGGGG + Intronic
1041501096 8:58539609-58539631 CTGGAAAGGCAAAATGACTCAGG + Intergenic
1041746908 8:61217291-61217313 TGGGAGGGGCCAAATGAAAGGGG + Intronic
1044696729 8:94930705-94930727 GTGGAAGCTCAAAATGAAATGGG - Exonic
1044817736 8:96130469-96130491 CTGCCAAGGCTAAATGAAAGTGG - Intergenic
1045260143 8:100565688-100565710 CTGAAAGGGCAAAATGCACTAGG + Intergenic
1045314951 8:101035570-101035592 CTGGAAGAGCAACAGGAATGAGG + Intergenic
1046094406 8:109540056-109540078 GTGGAAGGGCGAAAGGAAGGTGG - Intronic
1046137805 8:110052535-110052557 CTGGAAGGGGAGAGTGTAAGGGG + Intergenic
1046195172 8:110853372-110853394 CGAAAAGGGGAAAATGAAAGAGG - Intergenic
1046574736 8:116013299-116013321 ATGGAAGTGCAAAAAGAAAGAGG - Intergenic
1047735266 8:127759660-127759682 CTGGAAGGAGAAAATAAAACTGG - Intergenic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1048019543 8:130525834-130525856 CAGGAAGTGGAAAATGAAATAGG + Intergenic
1049053509 8:140217323-140217345 CTGGAATGGCACAAGGAAGGTGG + Intronic
1051547011 9:18288089-18288111 CAGGATGGGCAAAATAAATGGGG + Intergenic
1051813591 9:21078007-21078029 CTGAAAGGGAGAAGTGAAAGTGG - Intergenic
1052415786 9:28175374-28175396 TTGGAAGGAGAAAAAGAAAGAGG - Intronic
1052851448 9:33380824-33380846 CTGGAATGGAAAGAGGAAAGGGG - Intergenic
1053145951 9:35712220-35712242 CTGAAAGTGAAAAAAGAAAGGGG + Intronic
1054708128 9:68483711-68483733 CTGTAAGGGTCAGATGAAAGAGG + Intronic
1055207814 9:73753506-73753528 ATGGAAGGGCAGAAGAAAAGGGG + Intergenic
1055441625 9:76342379-76342401 TTGGAAGGGGAAAAAAAAAGAGG - Intronic
1055464442 9:76550283-76550305 CTTGCAGGGCCAAAAGAAAGGGG - Intergenic
1055525034 9:77124546-77124568 CTGGAAGGGCAAAGAGAAGAAGG - Intergenic
1056178630 9:84060527-84060549 CTGGAAGTCCAAGATCAAAGTGG - Intergenic
1056225668 9:84492879-84492901 CCCAAAGGCCAAAATGAAAGGGG - Intergenic
1056740035 9:89246470-89246492 CTGGAGGGACAAAGTGAATGAGG - Intergenic
1058183444 9:101825391-101825413 CGGGAAGGGCAAAATTAAATTGG + Intergenic
1058394017 9:104528881-104528903 CTGGAAGCACAAAAGGAATGGGG + Intergenic
1058411588 9:104738956-104738978 CGGGAAGGGAAAGAGGAAAGAGG + Intergenic
1058715304 9:107717393-107717415 CTGGAAGGGGATAATGGTAGGGG + Intergenic
1058918369 9:109589151-109589173 CTTGCAAGGCAAAAAGAAAGTGG - Intergenic
1059138628 9:111831297-111831319 CTGGAAGCGCAAAATCAAGTTGG + Intergenic
1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG + Intergenic
1060093369 9:120764626-120764648 CTGGATGGGCACAATGACACGGG - Exonic
1060920759 9:127418831-127418853 CTGGAAGGGACAGAGGAAAGAGG - Intergenic
1061679915 9:132237906-132237928 CTGGAGGGACAAAGTGAAGGGGG + Intronic
1061855100 9:133437726-133437748 CTGGGAGGGCAGAGTGAAAAAGG - Intronic
1186267526 X:7848456-7848478 CTGGAATTGAAAAATGACAGGGG + Intergenic
1186710015 X:12184032-12184054 CTGGAACTGCATATTGAAAGTGG + Intronic
1187093279 X:16119883-16119905 CTGGAAGGAAAAAATGAATTGGG - Intergenic
1187198297 X:17109460-17109482 CTTATAGGGCACAATGAAAGGGG + Intronic
1187247723 X:17567948-17567970 CTGGAAGGACAAAGTGAAATTGG - Intronic
1188515796 X:30984319-30984341 ATGGAAGGGTAAAATAAAGGAGG + Intergenic
1190775907 X:53552150-53552172 CTGGTATGGCATAATGAAACGGG - Intronic
1192001405 X:67155824-67155846 GTGGAATGGAAAAATGAAATGGG + Intergenic
1192167850 X:68836998-68837020 CAGGAAAGGCAGGATGAAAGTGG - Intronic
1192214777 X:69150609-69150631 AGGGAAGGGCAAAAGGAGAGGGG - Intergenic
1192259529 X:69496248-69496270 CAGCAGGGGCAAAAAGAAAGAGG - Intergenic
1194205818 X:91009812-91009834 GTGAAAGGGCAGAAAGAAAGAGG - Intergenic
1194360206 X:92941109-92941131 GTGGAAGGTGAAGATGAAAGAGG + Intergenic
1195098769 X:101532685-101532707 CTGTAAGGGGAATATGAAATGGG + Intronic
1196846410 X:119899884-119899906 GTGGAAGGGCTACATGAAAGTGG - Intronic
1197174963 X:123475823-123475845 CTTGAAGAGCAAAAATAAAGAGG + Intronic
1197357894 X:125459202-125459224 CTGTAAGAGCTAAATGAGAGGGG + Intergenic
1197544614 X:127809529-127809551 CTGGAGTGGAAAAATGCAAGTGG + Intergenic
1198037751 X:132818649-132818671 GTGGAAGAGCAAAAGGCAAGAGG + Intronic
1198619973 X:138496653-138496675 CAGAAAGGGAAAAATAAAAGAGG - Intergenic
1198910767 X:141611390-141611412 TAAGAAAGGCAAAATGAAAGAGG + Intronic
1200273552 X:154710940-154710962 CAAAAAGGGAAAAATGAAAGTGG - Intronic
1200551576 Y:4584623-4584645 GTGAAAGGGCAGAAAGAAAGAGG - Intergenic
1200668409 Y:6056926-6056948 GTGGAAGGTGAAGATGAAAGAGG + Intergenic
1201405284 Y:13643738-13643760 CTGGAAGTGAAAAATGTAACTGG + Intergenic