ID: 1060090078

View in Genome Browser
Species Human (GRCh38)
Location 9:120735038-120735060
Sequence GATTCTCACTGAAGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060090078_1060090081 9 Left 1060090078 9:120735038-120735060 CCTGCTGGGCTTCAGTGAGAATC No data
Right 1060090081 9:120735070-120735092 GGTGATGCAGCCTCCATCCTTGG No data
1060090078_1060090082 12 Left 1060090078 9:120735038-120735060 CCTGCTGGGCTTCAGTGAGAATC No data
Right 1060090082 9:120735073-120735095 GATGCAGCCTCCATCCTTGGTGG No data
1060090078_1060090083 13 Left 1060090078 9:120735038-120735060 CCTGCTGGGCTTCAGTGAGAATC No data
Right 1060090083 9:120735074-120735096 ATGCAGCCTCCATCCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060090078 Original CRISPR GATTCTCACTGAAGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr