ID: 1060095525

View in Genome Browser
Species Human (GRCh38)
Location 9:120785777-120785799
Sequence GATCCACCCTCCAAAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 0, 2: 17, 3: 124, 4: 633}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060095525_1060095528 -10 Left 1060095525 9:120785777-120785799 CCCAACACTTTGGAGGGTGGATC 0: 1
1: 0
2: 17
3: 124
4: 633
Right 1060095528 9:120785790-120785812 AGGGTGGATCACCTGAGGTCAGG 0: 1342
1: 31609
2: 71813
3: 96205
4: 100218
1060095525_1060095532 17 Left 1060095525 9:120785777-120785799 CCCAACACTTTGGAGGGTGGATC 0: 1
1: 0
2: 17
3: 124
4: 633
Right 1060095532 9:120785817-120785839 TGAGACCAGCCTGGGCAACAAGG 0: 7817
1: 53266
2: 123149
3: 178068
4: 175759
1060095525_1060095531 9 Left 1060095525 9:120785777-120785799 CCCAACACTTTGGAGGGTGGATC 0: 1
1: 0
2: 17
3: 124
4: 633
Right 1060095531 9:120785809-120785831 CAGGAGTTTGAGACCAGCCTGGG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
1060095525_1060095530 8 Left 1060095525 9:120785777-120785799 CCCAACACTTTGGAGGGTGGATC 0: 1
1: 0
2: 17
3: 124
4: 633
Right 1060095530 9:120785808-120785830 TCAGGAGTTTGAGACCAGCCTGG 0: 43524
1: 116818
2: 176857
3: 202641
4: 129199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060095525 Original CRISPR GATCCACCCTCCAAAGTGTT GGG (reversed) Intronic
900153319 1:1191068-1191090 GATCCGCCTGCCAAAGTGCTGGG + Intronic
901536758 1:9887464-9887486 CCTCCACCTTCCAAAGTGCTGGG - Intronic
901797186 1:11686651-11686673 CCTCCACCTGCCAAAGTGTTGGG + Intronic
901918691 1:12520178-12520200 CCTCCATCTTCCAAAGTGTTGGG - Intergenic
901918932 1:12522126-12522148 GACCGACCTCCCAAAGTGTTGGG - Intergenic
901990859 1:13112791-13112813 CATTCACTCTCCAAAGTGTCTGG - Intergenic
902013952 1:13291131-13291153 CATTCACTCTCCAAAGTGTCTGG + Intergenic
902028803 1:13405663-13405685 CATTCACTCTCCAAAGTGTCTGG + Intergenic
902124520 1:14197436-14197458 GATTCACCTCCCAAAGTGCTGGG - Intergenic
902447173 1:16474720-16474742 GATCCACCTGCCAAAGTGCTGGG - Intergenic
902467034 1:16624699-16624721 GATCCACCTGCCAAAGTGCTGGG - Intergenic
902507565 1:16948077-16948099 GATCCACCTGCCAAAGTGCTGGG + Intronic
902827183 1:18984137-18984159 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
902872241 1:19321427-19321449 GTCTCAGCCTCCAAAGTGTTGGG + Intronic
902872535 1:19323170-19323192 CACCCAGCCTCCAAAGTGTTGGG + Intronic
902950651 1:19880320-19880342 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
903459510 1:23510563-23510585 GATCGGCCTTCCAAAGTGTTGGG + Intronic
903506770 1:23841744-23841766 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
903533355 1:24049148-24049170 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
903592527 1:24468054-24468076 GCCCCACCTCCCAAAGTGTTGGG - Intronic
903917866 1:26777622-26777644 CTTCAACCTTCCAAAGTGTTGGG + Intronic
904100480 1:28022396-28022418 CATCCACCTCCCAAAGTGCTGGG + Intronic
904529371 1:31158006-31158028 GATCCGCCTCCCAAAGTGTTGGG - Intergenic
904544393 1:31257097-31257119 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
905068425 1:35204537-35204559 GATCCACCTCCCAAAATGCTGGG - Intergenic
905989754 1:42326008-42326030 GATCCGCCTCCCAAAGTGCTGGG - Intronic
906302657 1:44694748-44694770 GATTCACCCTCCTCAGTGCTGGG + Intronic
907231133 1:53000055-53000077 GATCCACCTTCCAAAGTGCTGGG + Intronic
908042873 1:60134028-60134050 GATGCAGGCTCTAAAGTGTTTGG - Intergenic
908141765 1:61192232-61192254 GAGCCACAGTGCAAAGTGTTGGG + Intronic
908350433 1:63281660-63281682 GATCCACTCTTCACAGAGTTTGG + Intergenic
908423929 1:63986640-63986662 CCTCCACCTCCCAAAGTGTTGGG - Intronic
908536806 1:65085781-65085803 GATTCTCCCGCCAAAGTGCTGGG - Intergenic
908716086 1:67070903-67070925 CCTCCACCTTCCAAAGTGCTAGG - Intergenic
908812278 1:67995163-67995185 GATCCACCTTCCAGAATGCTGGG - Intergenic
909004032 1:70254781-70254803 GATCCGCCTCCCAAAGTGCTGGG + Intergenic
909585815 1:77286594-77286616 CCTCCGCCTTCCAAAGTGTTGGG - Intronic
909653935 1:78008826-78008848 GAACCACTCTCTAAAGTTTTAGG + Intronic
910303739 1:85737812-85737834 CCTCCACCTCCCAAAGTGTTGGG + Intronic
911832116 1:102563704-102563726 GATCCACCCGCATAAGTGCTGGG - Intergenic
912355181 1:109049051-109049073 GCCTCACCCTCCAAAGTGCTGGG + Intergenic
912827855 1:112923073-112923095 CATCCACCTCCCAAAGTGCTGGG - Intronic
913369117 1:118077351-118077373 GATCCACCCTCCAGATTGCGTGG + Intronic
913977495 1:143474591-143474613 GATCCATCTCCCAAAGTGCTAGG - Intergenic
914071900 1:144300222-144300244 GATCCATCTCCCAAAGTGCTAGG - Intergenic
914107255 1:144666134-144666156 GATCCATCTCCCAAAGTGCTAGG + Intergenic
914262108 1:146007979-146008001 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
915220782 1:154372827-154372849 GATCCATCTCCCAAAGTGCTGGG - Intergenic
915901374 1:159848832-159848854 GATCTGCCCGCCAAAGTGCTGGG - Intronic
916418831 1:164617373-164617395 GAACCACCATCCATAGTCTTGGG - Intronic
918255664 1:182744376-182744398 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
918289013 1:183088051-183088073 GATCCGCCTCCCAAAGTGCTGGG + Intronic
918344461 1:183594163-183594185 GATCTTCCCACCTAAGTGTTGGG - Intronic
918367797 1:183827171-183827193 CCTCCACCTCCCAAAGTGTTGGG + Intronic
918613076 1:186513847-186513869 AAACCACCCTCCTAAGTCTTGGG + Intergenic
921134319 1:212246662-212246684 GATTCAGCCTCCAAAGTGCTGGG + Intergenic
924183304 1:241461093-241461115 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
924380080 1:243454827-243454849 GATGCACCCTCCACTGTGGTCGG + Intronic
924559662 1:245147170-245147192 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
924567579 1:245211307-245211329 GACTCACCATCCAAAGAGTTGGG + Intronic
924610300 1:245567931-245567953 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1063243609 10:4195530-4195552 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1063354140 10:5382261-5382283 CATCCACCTCCCAAAGTGCTGGG + Intergenic
1063492044 10:6472961-6472983 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
1063681087 10:8188586-8188608 GATCCACCCACCATAGAGATGGG - Intergenic
1064118971 10:12603149-12603171 GATCCACCTCCCAAAGTGCTGGG + Intronic
1064159783 10:12935126-12935148 CATCAGCCTTCCAAAGTGTTGGG + Intronic
1064213421 10:13380139-13380161 GATCCGCTCGCCAAAGTGCTGGG - Intergenic
1064237386 10:13588164-13588186 GATCTGCCCACCAAAGTGTGGGG - Intronic
1064974431 10:21098884-21098906 GTTCCACCTTACAAATTGTTGGG - Intronic
1065570164 10:27063006-27063028 GATCTACCTTCCAAAGTGCTGGG + Intronic
1065659439 10:27990424-27990446 TCTCCACCTTCCAAAGTGCTGGG + Intronic
1065802939 10:29368901-29368923 CCTCCACCTTCCAAAGTGCTAGG + Intergenic
1065907405 10:30270046-30270068 CCTCAACCTTCCAAAGTGTTGGG - Intergenic
1066733437 10:38452581-38452603 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1067027536 10:42857745-42857767 GATTGACCTTCCAAAGTGCTGGG + Intergenic
1067071428 10:43135454-43135476 GATTCACCTTCCAAAATGATGGG + Intergenic
1067092842 10:43278674-43278696 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
1067390563 10:45859134-45859156 CACCCACCTCCCAAAGTGTTGGG + Intergenic
1067853601 10:49770737-49770759 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1067872716 10:49976941-49976963 CACCCACCTCCCAAAGTGTTGGG - Intergenic
1068014561 10:51499687-51499709 GCTTCAGCCTCCAAAGTGCTGGG - Intronic
1068327646 10:55515227-55515249 GATCTGCCTTCCAAAGTGCTAGG + Intronic
1068608032 10:59027087-59027109 GTTCGACCTCCCAAAGTGTTGGG + Intergenic
1069411947 10:68163052-68163074 AATCCTCCCACCAAAGTGTTGGG - Intronic
1069628581 10:69883140-69883162 GAACCCTCCTCCAAAGTGCTTGG - Intronic
1070246639 10:74738529-74738551 AATCCTCCAGCCAAAGTGTTGGG - Intergenic
1070806436 10:79273722-79273744 GCTCCACCCTGCAAACTTTTTGG - Intronic
1070961060 10:80500567-80500589 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1071519498 10:86320306-86320328 GATCCACCCTCTACAATGTTTGG - Intronic
1071946700 10:90654168-90654190 GATCTGCCTCCCAAAGTGTTGGG - Intergenic
1072344325 10:94488640-94488662 CTTCCACCTTCCAAAGTGCTGGG + Intronic
1072497538 10:95976998-95977020 GCTCCACCTCCCAAAGTGTTGGG + Intronic
1072976840 10:100066199-100066221 TCTCCACCTCCCAAAGTGTTGGG + Intronic
1074089619 10:110236709-110236731 CCTCTACCTTCCAAAGTGTTGGG + Intronic
1074447181 10:113530173-113530195 GATCCACCTCGCAAAGTGCTAGG - Intergenic
1074515767 10:114167710-114167732 CATCAGCCTTCCAAAGTGTTGGG - Intronic
1075046720 10:119152057-119152079 GATCTACCTCCCAAAGTGTTGGG + Intronic
1076050967 10:127332811-127332833 GAGCCACCCTGCCAAGTGTGGGG + Intronic
1076303810 10:129449208-129449230 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
1076333462 10:129689177-129689199 GCCCCAGCCTCCAAAGTGCTGGG + Intronic
1076650790 10:131985812-131985834 CATCAACCTCCCAAAGTGTTGGG + Intergenic
1076989494 11:263917-263939 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1077632502 11:3820426-3820448 GATTCACCTGCCAAAGTGCTGGG - Intronic
1077869347 11:6248778-6248800 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1078141682 11:8697876-8697898 GCTCAGCCTTCCAAAGTGTTGGG - Intronic
1078208258 11:9248985-9249007 GATCCGCCCACCTAAGTGCTGGG - Intronic
1078240568 11:9527220-9527242 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1078851438 11:15167732-15167754 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1079172763 11:18111965-18111987 CATCAACCTCCCAAAGTGTTAGG + Intergenic
1079294088 11:19216617-19216639 GCTTCAGCCTCCAAAGTGCTAGG + Intergenic
1080276872 11:30512748-30512770 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1080359652 11:31497698-31497720 GATCCGCCTGCCAAAGTGTTGGG + Intronic
1080629217 11:34057968-34057990 ACTTCAGCCTCCAAAGTGTTGGG + Intronic
1080807356 11:35665836-35665858 GATCTGCCTGCCAAAGTGTTGGG + Intronic
1080877300 11:36288550-36288572 CCTCCGCCTTCCAAAGTGTTGGG - Intronic
1081069133 11:38587638-38587660 GATCCACCAGCCAAAGTGCTGGG + Intergenic
1081581187 11:44353266-44353288 GCCTCACCTTCCAAAGTGTTGGG - Intergenic
1081770094 11:45644964-45644986 TCTCCACCTCCCAAAGTGTTGGG + Intergenic
1081926946 11:46838385-46838407 GCTCCAGCATCCAAAGTGCTGGG - Intronic
1081976796 11:47240437-47240459 CCTCAACCTTCCAAAGTGTTGGG - Intronic
1082902512 11:58270698-58270720 GATCCACCCGCCAAAGTGCTGGG + Intergenic
1083024105 11:59535318-59535340 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1083029458 11:59578700-59578722 TCTCCACCTCCCAAAGTGTTAGG + Intronic
1083411216 11:62493719-62493741 TCTCCACCTCCCAAAGTGTTAGG + Intronic
1083675375 11:64322217-64322239 CCTCCACCCCCCAAAGTGCTGGG + Intergenic
1083863660 11:65441413-65441435 GCTCAACCTCCCAAAGTGTTGGG + Intergenic
1084586035 11:70063167-70063189 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1084621914 11:70277738-70277760 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
1084743226 11:71152362-71152384 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1084999814 11:73021836-73021858 ACTCCACCTCCCAAAGTGTTGGG - Intronic
1085221273 11:74875626-74875648 GATCCACCCGCCAAAGTGCTGGG - Intronic
1085273986 11:75286513-75286535 GATCCACCTCCCAAAGTGCTGGG + Intronic
1085292153 11:75408784-75408806 GATCCACCTCCCAAAGTGCTGGG + Intronic
1085540151 11:77260068-77260090 GATCCGCCCACCAAAGTGTTGGG - Intronic
1085593697 11:77789631-77789653 GCTCCACCCTCCACAGTGGCAGG + Intronic
1085794941 11:79530590-79530612 CATCCACCTCCCAAAGTGCTGGG + Intergenic
1086121497 11:83309315-83309337 GATCCACCCCAAAAAGTGCTGGG + Intergenic
1086925948 11:92640954-92640976 AATCCACCTTCCAAAGTGCTGGG - Intronic
1087494112 11:98867332-98867354 GATCCACTTCCCAAAGTGCTGGG - Intergenic
1087654814 11:100909582-100909604 GATCCATCTCCCAAAGTGCTGGG + Intronic
1087773452 11:102236354-102236376 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1089162197 11:116447185-116447207 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1089803502 11:121060105-121060127 TCACCACCCTCTAAAGTGTTTGG - Intronic
1089841549 11:121423121-121423143 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
1089979680 11:122762040-122762062 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1090146874 11:124334135-124334157 GATCCACCAGCCAAAGTGCTGGG - Intergenic
1091212726 11:133876418-133876440 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
1091482493 12:848053-848075 CTTCGGCCCTCCAAAGTGTTGGG + Intronic
1091696024 12:2628654-2628676 TCTCCGCCCTGCAAAGTGTTAGG - Intronic
1092025423 12:5235429-5235451 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
1092154221 12:6272017-6272039 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1092182887 12:6458135-6458157 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1092642262 12:10526729-10526751 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1093011638 12:14113252-14113274 GTTCCACCCTGGCAAGTGTTGGG + Intergenic
1093371116 12:18366290-18366312 GATCCACCTCCCAAAGTGCTGGG - Intronic
1093481575 12:19609275-19609297 CCTCGACCTTCCAAAGTGTTGGG + Intronic
1093565415 12:20597296-20597318 GATCCACCCAGCAATGAGTTGGG - Intronic
1093924939 12:24900688-24900710 AATCCACCTCCCAAAGTGCTGGG - Intronic
1093974978 12:25411790-25411812 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1094192954 12:27715375-27715397 GATCCACCCGCCTCAGTGCTGGG + Intronic
1094635626 12:32224940-32224962 GATCCACTCACTAAAGTGTTGGG + Intronic
1094770570 12:33653581-33653603 GATCTACCCACAAAAGTGATGGG - Intergenic
1095742299 12:45620835-45620857 GATCCACCTCCCAAAATGCTGGG - Intergenic
1096382438 12:51170573-51170595 TCTCCACCCCCCAAAGTGCTGGG + Intronic
1096396975 12:51273573-51273595 GATCCGCCTGCCAAAGTGCTGGG - Intergenic
1098361412 12:69657893-69657915 GACCCACCCTCCACTGTGTGAGG + Intronic
1098365051 12:69693513-69693535 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1099809811 12:87566899-87566921 GATCCACCTCTCAAAGTGCTGGG - Intergenic
1100183795 12:92114872-92114894 GATCCCCTCACCAAAGTGATTGG + Intronic
1100491613 12:95085327-95085349 GCTTCACCCTCCCAAGTGTCTGG + Intronic
1100502949 12:95191976-95191998 GATCCACCTCCCAAAATGCTAGG + Intronic
1100903409 12:99269807-99269829 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1100969410 12:100051803-100051825 GATCCTCTCTCCAAAGTGCTGGG - Intronic
1101129950 12:101678909-101678931 GCCTCAGCCTCCAAAGTGTTCGG - Intronic
1101256945 12:102987901-102987923 GATCCGCCTGCCAAAGTGCTGGG + Intergenic
1101420186 12:104544464-104544486 GATCCCCCCGCCAAAGTGCTGGG - Intronic
1101437471 12:104676651-104676673 GATCGGCCTCCCAAAGTGTTGGG + Intronic
1101656415 12:106724769-106724791 AATCCACCTCCCAAAGTGCTAGG - Intronic
1101861963 12:108489993-108490015 GATCCACCTACCAAAGTGCTGGG - Intergenic
1101894255 12:108743731-108743753 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1102902489 12:116649070-116649092 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1103328792 12:120139374-120139396 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1103377287 12:120467256-120467278 GATCCACCTCCCAAAGTGCTGGG - Intronic
1103499706 12:121391810-121391832 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1103515605 12:121506245-121506267 GATCGGCCTTCCAAAATGTTAGG + Intronic
1103600229 12:122050228-122050250 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1103617364 12:122162813-122162835 CTTCCACCTCCCAAAGTGTTGGG + Intergenic
1103623383 12:122201881-122201903 GATCCGCACGCCAAAGTGCTGGG - Intronic
1103799548 12:123528674-123528696 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
1105666857 13:22569167-22569189 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1105728878 13:23191933-23191955 GATCCGCCCACCTAAGTGCTGGG - Intronic
1106490829 13:30220208-30220230 CATCCACCTCCCAAAGTGTTGGG - Intronic
1107616132 13:42170295-42170317 CATCGGCCTTCCAAAGTGTTGGG - Intronic
1107879918 13:44824010-44824032 GCCTCAGCCTCCAAAGTGTTTGG + Intergenic
1107893056 13:44930930-44930952 CCTCCACCCCCCAAAGTGCTGGG + Intergenic
1107945607 13:45415498-45415520 CCTCCACCTTCCAAAGTGTTGGG - Intronic
1108194197 13:47975399-47975421 GATTCACCTCCCAAAGTGCTGGG + Intronic
1108677703 13:52751491-52751513 GATCCACCCCAGAAAGTGCTGGG - Intergenic
1108921742 13:55683442-55683464 GATCTGCCTTCCAAAGTGCTGGG + Intergenic
1109267265 13:60216175-60216197 GCTTCAACCCCCAAAGTGTTAGG + Intergenic
1109327179 13:60881898-60881920 GATTCACTCCCCAAAGTGTGGGG - Intergenic
1109784356 13:67154951-67154973 GATCCACCCACCTGAGTGGTGGG + Intronic
1110423759 13:75341861-75341883 TCTCCACCTCCCAAAGTGTTGGG - Intronic
1111410079 13:87864059-87864081 GCTCCACCTCCCAAAGTGCTGGG + Intergenic
1111477843 13:88776547-88776569 GATTCACCACCCAAAGTGCTGGG - Intergenic
1111821088 13:93215683-93215705 GCTTCAGCCTCCAAAGTGCTGGG + Intergenic
1111857770 13:93661452-93661474 GATCCACCTCCCAAAGTGCTGGG + Intronic
1112078069 13:95934757-95934779 GATTGACCTTCCAAAGTGGTGGG + Intronic
1114811078 14:25900411-25900433 AAGGCACCCTGCAAAGTGTTGGG + Intergenic
1115241047 14:31251318-31251340 CCTCCACCTCCCAAAGTGTTAGG + Intergenic
1115241347 14:31253454-31253476 GATCCACCTCCCAAAATGCTGGG - Intergenic
1115823577 14:37238698-37238720 AGTCCACCTTCCGAAGTGTTGGG - Intronic
1117146976 14:52845588-52845610 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1117304975 14:54465147-54465169 TCTCGACCCTCCAAAGTGCTGGG - Intergenic
1117783400 14:59257875-59257897 GACCAGCCCTGCAAAGTGTTGGG - Intronic
1118382770 14:65230957-65230979 CCTCCACCTTCCAAAGTGCTAGG - Intergenic
1118427472 14:65682250-65682272 CATCAACCTCCCAAAGTGTTGGG - Intronic
1118868296 14:69720293-69720315 GATACACCCTGAAAAGTGCTTGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119958792 14:78831295-78831317 GATCCACCTCCCAAAGTGCTGGG - Intronic
1121169075 14:91837485-91837507 GCTCCACCTCCCAAAGTGCTGGG + Intronic
1121203941 14:92145361-92145383 ACTCCACCTTCCAAAGTGCTGGG + Intronic
1121535644 14:94688942-94688964 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1121669335 14:95695837-95695859 GATCCACCTGCCAAAGTGCTGGG + Intergenic
1121842049 14:97142688-97142710 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1122190023 14:100034497-100034519 CTTCAACCTTCCAAAGTGTTGGG - Intronic
1122527181 14:102395547-102395569 CCTCAACCTTCCAAAGTGTTGGG - Intronic
1202941662 14_KI270725v1_random:154090-154112 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1123427199 15:20182605-20182627 GATTGACCTTCCAAAGTGCTGGG + Intergenic
1123433352 15:20236865-20236887 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1123536431 15:21189130-21189152 GATTGACCTTCCAAAGTGCTGGG + Intergenic
1124443554 15:29707945-29707967 CCTCCACCTCCCAAAGTGTTAGG - Intronic
1124948564 15:34293851-34293873 GTCTCAGCCTCCAAAGTGTTGGG + Intronic
1125042417 15:35206233-35206255 GTACCAGCCTCCAAAATGTTTGG - Intergenic
1125346622 15:38725123-38725145 GATTCTCCCTCCAGAGTGGTGGG + Intergenic
1125532578 15:40423186-40423208 CCTCCACTTTCCAAAGTGTTGGG + Intronic
1125804517 15:42481607-42481629 CATCAACCTCCCAAAGTGTTGGG + Intronic
1125974279 15:43937395-43937417 GATCCACCTCCCAAAGTGCTGGG - Intronic
1126013531 15:44327199-44327221 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1126478588 15:49092903-49092925 CCTCCACCTCCCAAAGTGTTAGG + Intergenic
1126640023 15:50814875-50814897 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1126708670 15:51431886-51431908 GATCCACCTCCCAAAGTGCTAGG - Intergenic
1127146114 15:56025692-56025714 CCTCAACCTTCCAAAGTGTTGGG - Intergenic
1127206621 15:56727217-56727239 GACCCACCTCCCAAAGTGCTGGG - Intronic
1127424462 15:58841350-58841372 CATAAACCTTCCAAAGTGTTGGG - Intronic
1127557060 15:60097960-60097982 GATCAACCCCCCAAAGTGCTGGG + Intergenic
1128579103 15:68796463-68796485 TCTCCACCTCCCAAAGTGTTGGG + Intronic
1129441458 15:75583868-75583890 CCTCCCCCTTCCAAAGTGTTGGG + Intergenic
1129481035 15:75826441-75826463 CTCCCAGCCTCCAAAGTGTTGGG + Intergenic
1129717210 15:77859519-77859541 GTCCCACCCCCGAAAGTGTTGGG + Intergenic
1130376235 15:83331638-83331660 GATCCACCTGCCAAAGTGCTGGG - Intergenic
1130982066 15:88819510-88819532 CCTCAACCTTCCAAAGTGTTGGG - Intronic
1131786908 15:95923195-95923217 GATCCACCTCCCAAAGTTCTGGG - Intergenic
1132839176 16:1970241-1970263 CCTCCTGCCTCCAAAGTGTTGGG + Intergenic
1133095368 16:3441434-3441456 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1133346866 16:5077033-5077055 GATCCACCTCCCAAAGTGCTGGG + Intronic
1133402731 16:5500470-5500492 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1133557999 16:6923918-6923940 GACTCAGCCTCCAAAGTGCTGGG - Intronic
1133789910 16:9001658-9001680 GATTCAGCCTCCCAAGTGCTGGG + Intergenic
1133935499 16:10265774-10265796 TCTCCACCTTCCAAAGTGCTGGG - Intergenic
1133963106 16:10511468-10511490 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1134160360 16:11883361-11883383 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1134183989 16:12068783-12068805 GATCCACCTCCCAAAGTGCTGGG + Intronic
1134585049 16:15403117-15403139 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1134817494 16:17218017-17218039 GATCCACCTCTCAAAGTGCTGGG - Intronic
1135244293 16:20841844-20841866 GATCCACCTCCCAAAGTGCTGGG + Intronic
1135352619 16:21741690-21741712 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1135451107 16:22557812-22557834 GATCCGCCTCCCAAAGTGCTGGG - Intergenic
1135711272 16:24719413-24719435 TACCCACCTCCCAAAGTGTTGGG - Intergenic
1135788906 16:25375512-25375534 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1135953552 16:26937228-26937250 GCTCAGCCCTCCAAAGTGCTGGG + Intergenic
1135999397 16:27279954-27279976 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1136191474 16:28617778-28617800 GATCCGCCTGCCAAAGTGCTGGG + Intronic
1136191581 16:28618592-28618614 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1136245087 16:28970569-28970591 GATCCTCCTGCCAAAGTGCTGGG + Intergenic
1136421715 16:30138470-30138492 GATCCACCTGCCAAAGTGCTGGG + Intergenic
1136689462 16:32018579-32018601 CTTCCACCTTCCAAAGTGCTGGG - Intergenic
1136790051 16:32962121-32962143 CTTCCACCTTCCAAAGTGCTGGG - Intergenic
1136857097 16:33667232-33667254 GATTGACCTTCCAAAGTGCTGGG - Intergenic
1136879762 16:33891815-33891837 CTTCCACCTTCCAAAGTGCTGGG + Intergenic
1137375265 16:47946833-47946855 GATCGGCCCCCCAAAGTGCTGGG - Intergenic
1137517513 16:49160525-49160547 GATTCACCTCCCAAAGTGCTGGG - Intergenic
1138478779 16:57287803-57287825 GATCCACCTGCCAAAGTGCTGGG - Intergenic
1139604912 16:68011277-68011299 GATCCACCCACCAAAGTGCTGGG - Intronic
1139797018 16:69491395-69491417 GATCCAGCTCCCAAAGTGCTGGG + Intergenic
1139828898 16:69780751-69780773 GCCCCACCTTCCAAAGTGCTGGG - Intronic
1140087052 16:71806489-71806511 CTTCCACCTCCCAAAGTGTTGGG + Intronic
1140110344 16:71998699-71998721 CCTCCACCTTCCAAAGTGCTAGG + Intronic
1140358112 16:74323101-74323123 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1141021953 16:80505702-80505724 CCTCCACCCTCCAAAATGCTGGG - Intergenic
1141047232 16:80726835-80726857 GCCTCAGCCTCCAAAGTGTTGGG - Intronic
1141061202 16:80872757-80872779 CCTCCACCTTCCAGAGTGTTGGG - Intergenic
1141513317 16:84526484-84526506 CATCTACCTCCCAAAGTGTTGGG + Intronic
1142022642 16:87793584-87793606 GATCCACCTCCCAAAGTGCTGGG - Intergenic
1203092255 16_KI270728v1_random:1223584-1223606 CTTCCACCTTCCAAAGTGCTGGG - Intergenic
1203118670 16_KI270728v1_random:1515707-1515729 GATTGACCTTCCAAAGTGCTGGG - Intergenic
1142662163 17:1438378-1438400 CCTCAACCTTCCAAAGTGTTGGG + Intronic
1142677078 17:1520481-1520503 GCTCCACCCTCCCAAGTGACAGG - Exonic
1143146176 17:4777488-4777510 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1143148586 17:4792297-4792319 GATTCTCCTTCCAAAGTGTTGGG - Intergenic
1143663606 17:8342981-8343003 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1144387108 17:14758956-14758978 GATCCGCCCACCAAAGTGCTGGG - Intergenic
1144441338 17:15285521-15285543 GATAAACCCTCCAAGGTGTTTGG + Intergenic
1144620191 17:16813726-16813748 GTCCCAGCCTCCAAAGTGCTGGG + Intergenic
1144766866 17:17737908-17737930 GATCCAGCCTCAGAAGTGTAAGG + Intronic
1146004610 17:29153391-29153413 CCTCAACCTTCCAAAGTGTTGGG + Intronic
1146268564 17:31469377-31469399 GATCCTCCTCCCAAAGTGCTGGG - Intronic
1146733041 17:35212281-35212303 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1147152304 17:38524726-38524748 CTTCCACCTTCCAAAGTGCTGGG - Intergenic
1147191972 17:38743339-38743361 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1147404814 17:40203649-40203671 GCTTCAGCCTTCAAAGTGTTGGG - Intergenic
1147647787 17:42044063-42044085 GAGCCACCTCCCAAAGTGCTGGG - Intronic
1147973186 17:44231191-44231213 AATCCCAACTCCAAAGTGTTGGG + Intergenic
1147990921 17:44332811-44332833 CATCCACCTCCCAAAGTGTCAGG + Intergenic
1149714678 17:58776980-58777002 GCTTCATCCTCCAAAGTGTTGGG - Intronic
1150027867 17:61697103-61697125 GATCCACCTCCCAAACTGCTGGG - Intronic
1150326070 17:64258996-64259018 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1150415075 17:64980894-64980916 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1150725015 17:67644673-67644695 GATCCACTCGCCAAAGTGCTGGG + Intronic
1150796551 17:68242783-68242805 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1150906855 17:69347356-69347378 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1152201308 17:78947999-78948021 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1152695009 17:81739783-81739805 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
1152840474 17:82564325-82564347 CATCCACCTCCCAAAGTGCTGGG + Intronic
1152847086 17:82607856-82607878 CTTCGACCCCCCAAAGTGTTGGG - Intronic
1153045892 18:855556-855578 CACCCACCCTCCCAAGTGCTGGG - Intergenic
1153544437 18:6191736-6191758 GCCACAGCCTCCAAAGTGTTGGG - Intronic
1154939240 18:21094496-21094518 GATCCTCCTCCCAAAGTGCTGGG - Intronic
1155951546 18:31919237-31919259 CACCCAGCCTCCAAAGTGTTAGG - Intronic
1155969070 18:32064233-32064255 GATCCACCTCCCAAAGTGCTGGG + Intronic
1156279564 18:35622500-35622522 GCCTCAGCCTCCAAAGTGTTAGG + Intronic
1156911839 18:42420134-42420156 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1157256245 18:46142252-46142274 AATCCACCCACCAAAGTGCTAGG + Intergenic
1157266413 18:46227057-46227079 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1157975783 18:52325326-52325348 GATCCACCTCCCAAAGTGCTGGG - Intergenic
1158289686 18:55925876-55925898 GACACATCCTCCAGAGTGTTGGG + Intergenic
1158561024 18:58513763-58513785 GATCCAGCCTCCAAAGTAACTGG - Intronic
1158578218 18:58658221-58658243 GCTCCACCCTTCAAAGCTTTAGG + Intergenic
1159704524 18:71670239-71670261 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1160243833 18:77141647-77141669 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1160814104 19:1027422-1027444 GCTCCGCCCCCCAAAGTGCTGGG - Intronic
1161371111 19:3912220-3912242 TCTCGACCTTCCAAAGTGTTGGG - Intronic
1161540696 19:4849544-4849566 AATCCTCCCACCAAAGTGCTGGG + Intronic
1161720923 19:5902213-5902235 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1161876715 19:6917486-6917508 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1162293181 19:9793843-9793865 GATCTTCCTTCCAAAGTGTTAGG - Intergenic
1162374069 19:10294813-10294835 CCTCAACCTTCCAAAGTGTTGGG - Intronic
1162521113 19:11180100-11180122 GATCCGCCTTCCAAAGTGCTGGG + Intronic
1162578749 19:11514771-11514793 TCTCCACCTCCCAAAGTGTTGGG + Intronic
1162904620 19:13816371-13816393 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1162949893 19:14064833-14064855 GATCCACCCCCCAAAGTGCTGGG + Intergenic
1163019890 19:14476282-14476304 GAACCACCCTCCTTAGTGCTGGG + Intergenic
1163457045 19:17413244-17413266 GATCCTCCTGCCTAAGTGTTGGG - Intronic
1163469798 19:17489490-17489512 GGTCCACCCTCCAAAGTTATAGG - Intronic
1163487977 19:17600411-17600433 CCTCAGCCCTCCAAAGTGTTGGG - Intergenic
1163532429 19:17858275-17858297 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1163823781 19:19511515-19511537 GATCCGCCTCCCAAAGTGCTGGG + Intergenic
1164872979 19:31662126-31662148 GTTCAGCCCTCCAAAGTGCTGGG - Intergenic
1165086278 19:33350118-33350140 CCTCAACCTTCCAAAGTGTTGGG - Intergenic
1165202796 19:34158968-34158990 GATCCACCCACCAAAGTGCTGGG - Intergenic
1165508547 19:36251392-36251414 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1165559661 19:36668044-36668066 CATCCACCTCCCAAAGTGCTGGG + Intergenic
1165568605 19:36755469-36755491 CACCCACCTCCCAAAGTGTTGGG + Intronic
1165632986 19:37317422-37317444 CATCCGCCTCCCAAAGTGTTGGG + Intronic
1166541086 19:43606397-43606419 GATCCACCCACCTCAGTGCTGGG + Intronic
1166806423 19:45489935-45489957 CATCAGCCCTCCAAAGTGCTGGG + Intronic
1166829595 19:45631095-45631117 CTTCCACCTTCCAAAGTGCTGGG + Intronic
1167345501 19:48943123-48943145 GCTTCAGCCTCCAAAGTGCTGGG - Intronic
1167450324 19:49564201-49564223 GCTTCAGCCTCCAAAGTGCTGGG - Intronic
1168030219 19:53673546-53673568 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1168261066 19:55194935-55194957 GCTCCTCCTCCCAAAGTGTTGGG - Intronic
1168555081 19:57331560-57331582 GCTCAACCTTCCAAAGTGTTGGG + Intergenic
1168603001 19:57735196-57735218 GCTCCACCTCCCAAAGTGCTGGG - Intronic
1168625976 19:57918194-57918216 GCCTCACCCTCCAATGTGTTGGG + Intergenic
925047462 2:784066-784088 CTTCCACCCCCCAAAGTGCTGGG - Intergenic
925750975 2:7090339-7090361 GATCCAGCCTCCAAAGTCCAGGG - Intergenic
925913032 2:8585766-8585788 GATCCACCCGCCTAAATGCTGGG + Intergenic
926043923 2:9695737-9695759 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
926652365 2:15360598-15360620 CCTCAACCTTCCAAAGTGTTGGG + Intronic
926945043 2:18178324-18178346 GATCTAACCTCCAAACTCTTAGG + Intronic
927669208 2:25054556-25054578 GATCCGCCTGCCAAAGTGTTGGG + Intronic
927839182 2:26427364-26427386 CCTCCACCTTCCAAAGTGTTGGG + Intronic
928011471 2:27611934-27611956 GATCCACCCCCTAGAGTGCTGGG + Intronic
928394377 2:30932371-30932393 ATACCACCCTCCAAAGTGGTAGG - Intronic
928536754 2:32248567-32248589 CCTCCACCTTCCAAACTGTTGGG - Intronic
928586745 2:32767034-32767056 GCTTGACCTTCCAAAGTGTTGGG + Intronic
928620969 2:33087316-33087338 CCTCCACCTCCCAAAGTGTTGGG + Intronic
929015338 2:37487931-37487953 GATCCGCCCACCTAAGTGCTGGG - Intergenic
929842083 2:45477663-45477685 CCTCACCCCTCCAAAGTGTTGGG + Intronic
930149570 2:48044710-48044732 GCTCGACCTTCCAAAGTGCTAGG - Intergenic
931287143 2:60841744-60841766 GATCCACCTCCCAAAGTGCTGGG - Intergenic
931419186 2:62110318-62110340 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
931446729 2:62333009-62333031 GTTCCTCCCTCCACAGTGTCAGG - Intergenic
931651006 2:64468675-64468697 TTTCCACCTCCCAAAGTGTTGGG - Intergenic
932400054 2:71474174-71474196 CATCCACCTCCCAAAGTGCTGGG + Intronic
932573268 2:72949557-72949579 CCTCCACCTTCCAAAGTGTTGGG + Intronic
932650446 2:73550108-73550130 CCTCCACCTTCCAAAGTGCTGGG + Intronic
933251922 2:80038603-80038625 GATCCCCTCCCCAAAGTGCTGGG - Intronic
933337280 2:80974659-80974681 GATTCACCTCCCAAAGTGCTGGG - Intergenic
933830874 2:86207398-86207420 GATCCACCCGCCAAAGTGCTGGG - Intronic
934071740 2:88390484-88390506 AATCCACCTCCCAAAGTGCTTGG - Intergenic
934182201 2:89635587-89635609 GATCCATCTCCCAAAGTGCTAGG - Intergenic
934292500 2:91709796-91709818 GATCCATCTCCCAAAGTGCTAGG - Intergenic
934962511 2:98689571-98689593 GCTTCAGCCTCCAAAGTGTTGGG - Intronic
935514401 2:104018767-104018789 CATCAACCCCACAAAGTGTTTGG + Intergenic
935777127 2:106483582-106483604 CCTCCACCTCCCAAAGTGTTAGG + Intergenic
936026750 2:109036891-109036913 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
936048578 2:109205498-109205520 CATCCACCTCCCAAAGTGCTGGG + Intronic
936817364 2:116475263-116475285 GCTTCAGCCTCCAAAGTGCTGGG + Intergenic
937052886 2:118906650-118906672 GATACACCCTTCAAAGTTGTTGG - Intergenic
937107729 2:119334041-119334063 CCTCCACCTTCCAAAGTGTTGGG + Intronic
938017304 2:127877804-127877826 GATCGACCTCCCAAAGTGTTGGG - Intronic
938861309 2:135372545-135372567 GATCCGCCTCCCAAAGTGCTGGG - Intronic
938914055 2:135916944-135916966 GATCCTCCTCCCAAAGTGCTGGG - Intronic
939378067 2:141396870-141396892 GATCCACCTCCCAAAGTGCTGGG - Intronic
939499189 2:142960943-142960965 GCTCCAGCCTCCCAAGTGCTGGG - Intronic
939736911 2:145858499-145858521 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
940274254 2:151922451-151922473 GCTCCACCTCCCAAAGTGCTGGG + Intronic
941964133 2:171283819-171283841 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
942048425 2:172115231-172115253 GCTCCACCTCCCAAAGTGCTGGG - Intergenic
942149917 2:173065205-173065227 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
942242414 2:173974930-173974952 CCTCCACCTCCCAAAGTGTTAGG + Intergenic
942467705 2:176225889-176225911 TTTCCGCCTTCCAAAGTGTTGGG + Intergenic
942533097 2:176933908-176933930 GATCCACCTGCCAAAGTGCTGGG + Intergenic
943127365 2:183811405-183811427 AATCCACCTCCCAAAGTGCTGGG - Intergenic
943328165 2:186526292-186526314 GCTTCAGCCTCCAAAGTGCTGGG - Intergenic
943851382 2:192727493-192727515 GATCCATACTCTAAAGTGTTAGG - Intergenic
944146957 2:196515871-196515893 CCTCCACCTCCCAAAGTGTTGGG - Intronic
944652040 2:201840223-201840245 GATCAGCCTCCCAAAGTGTTGGG + Intronic
944925222 2:204457215-204457237 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
945129687 2:206557178-206557200 CCTCCACCTGCCAAAGTGTTGGG + Intronic
945298459 2:208193803-208193825 GATCCGCCCGCCAAAGTGCTGGG - Intergenic
945401293 2:209386592-209386614 CCTCCACCCTCCAAAGTGCTGGG + Intergenic
946091585 2:217229684-217229706 GATCCACCCACCAAAGTGCTGGG + Intergenic
946648254 2:221863601-221863623 GATCCGCCTTCCAAAGTGCAGGG - Intergenic
947203361 2:227637080-227637102 ATCCCACCCCCCAAAGTGTTGGG - Intergenic
947541456 2:230982636-230982658 GATCCTCCCACCACAGTGCTGGG - Intergenic
947608868 2:231509576-231509598 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
949013784 2:241697830-241697852 CATCAGCCTTCCAAAGTGTTGGG - Intergenic
1168966280 20:1900338-1900360 GATCCACCTCCCAAAGTGCTGGG + Intronic
1169132960 20:3176502-3176524 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1169438774 20:5616550-5616572 CATCCACCTCCCAAAGTGCTGGG + Intergenic
1169788873 20:9388466-9388488 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1170298709 20:14858069-14858091 CCTCCGCCCTCCAAAGTGCTGGG + Intronic
1170648660 20:18219310-18219332 CTTCAGCCCTCCAAAGTGTTGGG - Intergenic
1171573162 20:26272768-26272790 CGTCAACCTTCCAAAGTGTTGGG - Intergenic
1171792305 20:29538414-29538436 CCTCAACCTTCCAAAGTGTTGGG - Intergenic
1171837702 20:30172639-30172661 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1172232163 20:33344043-33344065 GATCCACCTCCCAAAGTGCTGGG - Intergenic
1172537614 20:35686207-35686229 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1172545275 20:35756023-35756045 GCTCATCCTTCCAAAGTGTTGGG - Intergenic
1172562436 20:35901172-35901194 GATCCACCTCCCAAAGTGCTGGG - Intronic
1172586469 20:36088728-36088750 GCTCGACCTTCCAAAGTGTTGGG + Intergenic
1172733889 20:37111252-37111274 GCTCAACCTCCCAAAGTGTTGGG - Intronic
1173561538 20:44009373-44009395 GATCCACATTTCATAGTGTTTGG + Intronic
1174022918 20:47545963-47545985 CCTCAACCTTCCAAAGTGTTGGG + Intronic
1174216084 20:48917575-48917597 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG + Intergenic
1174883332 20:54304497-54304519 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
1175149154 20:56919482-56919504 GATCCGCCTTCCAAAGTGCTGGG - Intergenic
1176156057 20:63621423-63621445 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1176168015 20:63684591-63684613 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1176798949 21:13403437-13403459 GATCTGCCCTCCAAAGTCCTGGG - Intergenic
1177544965 21:22544826-22544848 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1178362289 21:31958618-31958640 GATCCACCTCCCAAAGTGCTGGG + Intronic
1178798635 21:35770292-35770314 ACTCCACCCTCCAAAGTGCTAGG - Intronic
1178987402 21:37318534-37318556 GCCTCAGCCTCCAAAGTGTTAGG - Intergenic
1179795080 21:43777953-43777975 GATCCATCCCCCAAAGTGCTGGG + Intergenic
1180001747 21:44998309-44998331 GACCCACCCTCCAGAAGGTTTGG + Intergenic
1180574089 22:16756718-16756740 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1181649437 22:24250627-24250649 GATCCCCCTCCCAAAGTGCTGGG - Intergenic
1181771553 22:25129266-25129288 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1182017520 22:27053029-27053051 AATCCACCCTCCCAGGTGCTCGG + Intergenic
1182180423 22:28341399-28341421 CATCCACCTTCCAAAGTGTTGGG - Intronic
1182562261 22:31169796-31169818 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1182644626 22:31798171-31798193 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1182733773 22:32516046-32516068 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1183462941 22:37963520-37963542 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
1183612282 22:38917275-38917297 GATCCACCTGCCAAAGTGCTGGG + Intergenic
1183888069 22:40901713-40901735 AATCCACCCACCAAAGTGCTGGG + Intronic
1183957012 22:41386801-41386823 GATCCACCCACCAAAGTGCTGGG - Intronic
1184150570 22:42635962-42635984 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1184779741 22:46641321-46641343 TGTCAACCTTCCAAAGTGTTAGG + Intronic
1185303892 22:50101453-50101475 GATCCACCTGCCAAAGTGCTGGG + Intronic
949212227 3:1516721-1516743 GAGCCACCCTACAAATAGTTGGG + Intergenic
949551021 3:5113142-5113164 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
950513804 3:13450672-13450694 CTTCCACCTCCCAAAGTGTTAGG - Intergenic
950732751 3:14976022-14976044 CCTCCACCTTCCAAAGTGCTGGG + Intronic
950907794 3:16554798-16554820 TCTCCACCTCCCAAAGTGTTAGG - Intergenic
950984576 3:17347756-17347778 GATTCTCCCACCTAAGTGTTAGG - Intronic
951425064 3:22535191-22535213 CATTCACCTTCCAAAGTGATTGG + Intergenic
951702820 3:25513037-25513059 GATCCACCTCCCAAAGTGCTGGG - Intronic
952093484 3:29920723-29920745 CCTCCACCTTCCAAAGTGCTGGG - Intronic
952131739 3:30371940-30371962 GAACCACCCTCAAGAATGTTTGG + Intergenic
952158218 3:30666884-30666906 GATTCTCCCGCCAAAGTGCTAGG + Intronic
952247284 3:31607848-31607870 CCTCCGCCTTCCAAAGTGTTGGG + Intronic
952459143 3:33505801-33505823 CCTCCACCTCCCAAAGTGTTGGG - Intronic
952701203 3:36329424-36329446 GCTCGGCCTTCCAAAGTGTTGGG - Intergenic
953840476 3:46386164-46386186 CCTCCACCTTCCAAAGTGCTAGG + Intergenic
954209147 3:49084194-49084216 CTTCCACCTTCCAAAGTGCTGGG + Intronic
954606141 3:51911415-51911437 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
954768293 3:52941654-52941676 GTTCCTCCTTTCAAAGTGTTGGG - Intronic
955287036 3:57651956-57651978 GATCCTCCCACCTAGGTGTTGGG - Intronic
955659809 3:61286055-61286077 GCTTCAGCCTCCAAAGTGCTAGG - Intergenic
956012801 3:64849451-64849473 GATCCACCTCCCAAAGGGCTGGG + Intergenic
956093309 3:65690718-65690740 GATCCACCTCCCAATGTGCTGGG + Intronic
956121973 3:65975503-65975525 CCTCCACCTTCCAAAGTGCTGGG - Intronic
956424064 3:69114745-69114767 GATCGACCTCCCAAAGTGCTGGG + Intronic
956622162 3:71232646-71232668 CCTCCACCTCCCAAAGTGTTGGG - Intronic
956656908 3:71561294-71561316 GATCTGCCCACCAAAGTGCTAGG + Intronic
956837186 3:73104879-73104901 GATCCACCTGCCAAAGTGCTGGG + Intergenic
956946007 3:74224302-74224324 CATCGGCCTTCCAAAGTGTTGGG + Intergenic
957114489 3:76007991-76008013 GATCCACCTCCCAAAGTGCTGGG - Intronic
957425980 3:80039280-80039302 GATCCACCCGCCAAAGTGCTGGG + Intergenic
957517404 3:81273764-81273786 CCTCGACCTTCCAAAGTGTTGGG - Intergenic
960512016 3:118561253-118561275 GATCCACCTCTCAAAGTGCTGGG + Intergenic
960727776 3:120688039-120688061 GACCCGCCTCCCAAAGTGTTGGG + Exonic
960905712 3:122599144-122599166 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
961124767 3:124407072-124407094 GATCCACCTGCGAAAGTGTTGGG + Intronic
961763547 3:129189881-129189903 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
961970923 3:130966508-130966530 GTCCCAGCCTCCCAAGTGTTAGG + Intronic
962158605 3:132975557-132975579 TATCCACCCTCAAAAGTTTTTGG - Intergenic
963300506 3:143592274-143592296 CTTCCACCCTGCAAAGTGCTGGG - Intronic
964142666 3:153421567-153421589 CCTCCACCCCCCAAAGTGTTGGG - Intergenic
964301934 3:155297781-155297803 CCTCCACCTTCCAAAGTGCTAGG - Intergenic
964551529 3:157890200-157890222 GATCCACCCACCAAAGTGCTGGG + Intergenic
964794524 3:160482666-160482688 AATCCTCCCACCAAAGTGCTGGG + Intronic
965005760 3:163020081-163020103 CCTCCACCTTCCAAAGTGCTGGG + Intergenic
965266657 3:166552289-166552311 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
965527920 3:169740917-169740939 GATCCATCCACCAAAGTGCTGGG - Intergenic
965831391 3:172793401-172793423 AATCCACCTGCCAAAGTGCTGGG + Intronic
966742616 3:183248582-183248604 CCTCCACCTGCCAAAGTGTTAGG - Intronic
966931768 3:184679773-184679795 GATCCGCCTTCCAGAGTGCTGGG - Intronic
967160263 3:186730411-186730433 GATCCACCCACCAAAATGCTGGG - Intronic
967431505 3:189391377-189391399 GATCTGCCTCCCAAAGTGTTGGG + Intergenic
968032337 3:195511106-195511128 GATCCACCTCCCAAAGTGCTGGG - Intergenic
968078783 3:195832499-195832521 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
968948128 4:3676225-3676247 CATCCACGCTCCTAAGTGTCAGG + Intergenic
970294192 4:14610885-14610907 GAATCCTCCTCCAAAGTGTTGGG - Intergenic
970710412 4:18855607-18855629 GACCCACCTTGCAAAGTGCTGGG - Intergenic
970782279 4:19752128-19752150 CATCGGCCTTCCAAAGTGTTGGG + Intergenic
970782836 4:19759444-19759466 GATCCTCCCACCTAAGTGTTGGG - Intergenic
971233460 4:24819569-24819591 CATCCACCTCCCAAAGTGCTAGG + Intronic
972466026 4:39357855-39357877 GATCCACCTCCCAAAGTGCCAGG + Intronic
972520028 4:39844965-39844987 GATCCACCTCCCAAAGTGCTGGG - Intronic
974814882 4:66991066-66991088 GATCTACCTGCCAAAGTGCTGGG + Intergenic
975141865 4:70926754-70926776 GATCCACCTCCCAAAATGCTGGG - Intronic
975324595 4:73045073-73045095 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
975406317 4:73994626-73994648 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
975721030 4:77248697-77248719 AATCCATGCTCCAAGGTGTTTGG - Intronic
976292300 4:83432794-83432816 CATCAGCCCTCCAAAGTGCTGGG - Intronic
976301404 4:83518930-83518952 GATCCACCTCCCAAAGTGCTGGG - Intronic
976898323 4:90139700-90139722 CATCCGCCTTCCAAAGTGCTAGG - Intronic
977248092 4:94657944-94657966 GATCCACCTCCCAAAGTGCCGGG + Intronic
977657738 4:99542002-99542024 GATCCACTCTCCTGAGTGTTAGG - Exonic
977879998 4:102193048-102193070 CATCAACCTTCCAAAGTGCTGGG + Intergenic
978343625 4:107742588-107742610 AATCCACCTCCCAAAGTGTTGGG - Intergenic
979586688 4:122427774-122427796 GCTCCACCCACCAAAGTGCTGGG + Intronic
979622108 4:122810166-122810188 GATCCGCCTTCCAAAGTGCTGGG - Intergenic
980177922 4:129369139-129369161 GATCCACTATCCAAAATTTTAGG + Intergenic
980641570 4:135586519-135586541 GATCCACCTGCCAAAGTGCCAGG - Intergenic
980739082 4:136927848-136927870 GCTCCACCTCCCAAAGTGCTTGG + Intergenic
981295434 4:143125863-143125885 CCTCCACCTTCCAGAGTGTTGGG + Intergenic
981872388 4:149502415-149502437 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
982260706 4:153491948-153491970 CACCCACTCCCCAAAGTGTTGGG + Intronic
982329537 4:154165732-154165754 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
984083745 4:175282761-175282783 GATCCGCCTCCCAAAGTGATGGG - Intergenic
984528771 4:180889776-180889798 GATCCGCCTCCCAAAGTGCTGGG + Intergenic
984714523 4:182914256-182914278 TCTCCACCTCCCAAAGTGTTGGG + Intronic
985023696 4:185717988-185718010 GGTCCACCTCCCAAAGTGTCGGG - Intronic
985982875 5:3487000-3487022 TCTCCACCTCCCAAAGTGTTAGG - Intergenic
986263310 5:6168024-6168046 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
986595830 5:9420762-9420784 ATTCCACCTCCCAAAGTGTTGGG - Intronic
986768180 5:10947305-10947327 CCTCCACCTTCCAAAGTGCTAGG - Intergenic
987427395 5:17789012-17789034 GCTTCAGCCTCCAAAGTGTTGGG - Intergenic
987607313 5:20153859-20153881 GCTCCAACCCCCAAAGTATTCGG - Intronic
987991347 5:25216715-25216737 CACCCACCTTCCAAAGTGCTGGG - Intergenic
988416650 5:30954199-30954221 GATCCGCCTCCCAAAGTGCTGGG - Intergenic
988452682 5:31359013-31359035 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
988886210 5:35560886-35560908 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
988980649 5:36564772-36564794 CCTCCACCTTCCAAAGTGTTGGG - Intergenic
990533083 5:56693500-56693522 GCTCCACCTCCCAAAGTGTCGGG - Intergenic
990751792 5:59024140-59024162 GATCGACCTCCCAAAGTGCTGGG + Intronic
991361606 5:65826652-65826674 CCTCAACCTTCCAAAGTGTTAGG - Exonic
992026017 5:72669773-72669795 CCTCCACCTTCCAAAGTGTTTGG - Intergenic
992079358 5:73219462-73219484 GATCCGCCTCCCAAAGTGCTGGG + Intergenic
992940680 5:81758399-81758421 TCTCGACCTTCCAAAGTGTTGGG - Intergenic
993693800 5:91036246-91036268 CCTCAACCTTCCAAAGTGTTGGG - Intronic
993731155 5:91424426-91424448 CACCCACCTCCCAAAGTGTTGGG + Intergenic
994003770 5:94813643-94813665 GATCCACCATCCAAAGTACTGGG - Intronic
994070338 5:95594589-95594611 CCTCCACCTCCCAAAGTGTTGGG - Intronic
995341226 5:111062894-111062916 CTTTGACCCTCCAAAGTGTTGGG - Intergenic
995391921 5:111649288-111649310 CCTCAACCATCCAAAGTGTTGGG + Intergenic
996531983 5:124535930-124535952 GATCTACCTCCCAAAGTGCTGGG - Intergenic
997504993 5:134410373-134410395 GATCCTCCTCCCAAAGTGCTAGG + Intronic
998373496 5:141676107-141676129 GATCCGCCTGCCAAAGTGCTGGG - Intronic
998467748 5:142359032-142359054 GGTTCACCCTCCCAAGTGTCAGG - Intergenic
998836582 5:146207893-146207915 GATCCGCCTCCCAAAGTGCTGGG + Intronic
999080560 5:148839432-148839454 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
999229761 5:150054734-150054756 CATCAACCTCCCAAAGTGTTGGG - Intronic
999256985 5:150215177-150215199 GTCTCAGCCTCCAAAGTGTTAGG + Intronic
1000084511 5:157877607-157877629 GCTTCAGCCTCCAAAGTGCTGGG + Intergenic
1000307445 5:160007972-160007994 TGTCCACCTTCCAAAGTGCTGGG + Intergenic
1000629793 5:163579354-163579376 CATCCAACTTCCAAAGTGCTGGG + Intergenic
1000726905 5:164783049-164783071 AATCCACTTTCCAAAGTGCTGGG + Intergenic
1001551442 5:172604950-172604972 AATCCACCTGCCAAAGTGCTGGG - Intergenic
1002398776 5:178978999-178979021 CCTCCACCTCCCAAAGTGTTCGG - Exonic
1002629475 5:180561200-180561222 GCTTCAGCCTCCAAAGTGCTGGG + Intronic
1003711372 6:8594772-8594794 GATCGGCCTCCCAAAGTGTTGGG - Intergenic
1003750450 6:9049290-9049312 CCTCGACCCTCCAAAGTGCTGGG + Intergenic
1003865806 6:10361372-10361394 CCTCCACCTCCCAAAGTGTTTGG - Intergenic
1004607744 6:17209618-17209640 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1005194038 6:23261641-23261663 GTTCCACCTCCCAAAGTGCTGGG - Intergenic
1005261883 6:24069993-24070015 CATCCACCTTCCGAAGTGTTGGG - Intergenic
1005262034 6:24071563-24071585 CCTCCACCTTCCAAAGTGTTGGG - Intergenic
1005455424 6:26015480-26015502 CATCGACCTCCCAAAGTGTTGGG - Intergenic
1005518722 6:26579373-26579395 CTTCCACCCCCCAAAGTATTGGG + Intergenic
1006126692 6:31843418-31843440 CACCCACCTCCCAAAGTGTTGGG + Intergenic
1006648616 6:35532931-35532953 CCTCCACCTTCCAAAGTGCTAGG + Intergenic
1006759839 6:36450235-36450257 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1006827733 6:36948546-36948568 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1006865366 6:37205372-37205394 GCTCTGCCTTCCAAAGTGTTGGG - Intergenic
1006886214 6:37384390-37384412 GCTCCGCCCCCCAAAGTGCTGGG + Intronic
1007283880 6:40733542-40733564 GATACACAGGCCAAAGTGTTTGG + Intergenic
1007903552 6:45435606-45435628 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1008417726 6:51262572-51262594 CAGCCAGCCTCCAAAGCGTTTGG + Intergenic
1008523303 6:52383024-52383046 GATCAGCCTCCCAAAGTGTTGGG + Intronic
1008618523 6:53249192-53249214 GATCCGCCTCCCAAAGTGCTGGG - Intergenic
1010234636 6:73565089-73565111 CCTCGACCCACCAAAGTGTTGGG - Intergenic
1011661748 6:89600783-89600805 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1012686110 6:102251901-102251923 CCTCCACCTCCCAAAGTGTTAGG - Intergenic
1013013470 6:106140966-106140988 GATCGACCTCCCAAAGTGCTGGG - Intergenic
1013192205 6:107813110-107813132 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1013257691 6:108405595-108405617 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1014407921 6:121074508-121074530 GATCCACCTCCCAGAGTGCTGGG - Intergenic
1014819552 6:125972095-125972117 GATCCTCCTCCCAAAGTGTTGGG + Intronic
1015777549 6:136829684-136829706 CCTCGACCTTCCAAAGTGTTAGG - Intronic
1015941129 6:138453222-138453244 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1016173350 6:141047468-141047490 GATCCGCCTCCCAAAGTGCTGGG - Intergenic
1016551188 6:145281861-145281883 CATCCACCTCCCAAAGTGCTGGG + Intergenic
1017112788 6:150948572-150948594 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1017524862 6:155233716-155233738 GATCCTCCCACCAAACTGCTGGG - Intronic
1017864393 6:158430490-158430512 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1021005684 7:15392319-15392341 GATCCGCCTCCCAAAGTGTTGGG + Intronic
1021575888 7:22105437-22105459 GATGCATCATCAAAAGTGTTTGG + Intergenic
1024025302 7:45405004-45405026 GATCCTCCTTCCAAAGTGCTGGG + Intergenic
1025958762 7:66202821-66202843 GCTCCACCTTCCAAAGTGACGGG - Intergenic
1026271437 7:68840402-68840424 CCTCCACCTTCCAAAGTGTTGGG + Intergenic
1026331273 7:69354569-69354591 AATCCTCCTCCCAAAGTGTTGGG - Intergenic
1026729019 7:72895076-72895098 CCTCCACCTTCCAAAGTGTTGGG + Intronic
1026844301 7:73689295-73689317 CCTCAACCTTCCAAAGTGTTGGG + Intronic
1026943423 7:74301640-74301662 CCTCCACCTCCCAAAGTGTTGGG + Intronic
1027019451 7:74801469-74801491 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1027068575 7:75144472-75144494 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1027131809 7:75596634-75596656 CCTCCACCTTCCAAAGTGCTGGG + Intronic
1027238765 7:76313979-76314001 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1027271575 7:76522801-76522823 GCTCCACCTCCCAAAGTGCTGGG - Intergenic
1027416969 7:77983811-77983833 GATCCTCCTGCCAAAGTGCTGGG + Intergenic
1027529728 7:79315423-79315445 CCTCAGCCCTCCAAAGTGTTAGG + Intronic
1028101627 7:86827752-86827774 GATCCACCTCCCAAAGTGCTGGG + Intronic
1028130191 7:87162309-87162331 GATCCTCCTCCCAAAGTGCTGGG + Intronic
1029461382 7:100695634-100695656 GATCCTCCTTCCAAAGTGCCGGG + Intergenic
1029583774 7:101456422-101456444 GATCCACCTCCCAAAGTGCTGGG - Intronic
1029661147 7:101962959-101962981 GATCCTCCTCCCAAAGTGCTGGG + Intronic
1029689582 7:102172330-102172352 TATCCACCTCCCAAAGTGCTGGG + Intronic
1030061784 7:105627780-105627802 CCTCCACCTTCCAAAGTGGTGGG + Intronic
1030681698 7:112441019-112441041 CAGCCTCCCACCAAAGTGTTGGG - Intronic
1030684036 7:112465146-112465168 CCTCCTCCTTCCAAAGTGTTGGG + Intronic
1031586429 7:123535827-123535849 AATCCGCCTTCAAAAGTGTTGGG + Intergenic
1031591392 7:123596359-123596381 TACCCACCCTTCAAAGTGTTGGG - Intronic
1032015261 7:128375951-128375973 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1032176085 7:129627455-129627477 AAGCAATCCTCCAAAGTGTTGGG + Intronic
1032207827 7:129884165-129884187 CATCGGCCCCCCAAAGTGTTGGG - Intronic
1032240817 7:130157473-130157495 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1032898591 7:136280538-136280560 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1033008265 7:137590937-137590959 GATCCGCCCGCCAAAGTGCTGGG + Intronic
1033078658 7:138273282-138273304 GATCCACCTCCCAAAGTACTGGG - Intergenic
1033294937 7:140123829-140123851 GATCCGCCCACCAAAGTACTGGG - Intronic
1034610119 7:152359517-152359539 ACTCGACCCTCCAAAGTGCTGGG - Intronic
1035836939 8:2764823-2764845 GATCCACCCTCTCCAGTGTGAGG + Intergenic
1036395871 8:8370896-8370918 AATCCACCTGCCAAAGTGTTGGG - Intronic
1036425598 8:8642677-8642699 CATTCTCCCTCCAAAGAGTTAGG - Intergenic
1036918651 8:12830677-12830699 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1037334428 8:17778564-17778586 CCTCCTCCCTCCAAAGTGCTGGG - Intronic
1037482275 8:19315384-19315406 TGTCCACCTCCCAAAGTGTTGGG + Intronic
1038174986 8:25173785-25173807 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1038241704 8:25815476-25815498 CCTCCACCCCCCAAAGTGCTGGG - Intergenic
1038292805 8:26265105-26265127 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1038299577 8:26330568-26330590 GATCCACCCGCCTCAGTGCTGGG + Intronic
1039101584 8:33947397-33947419 GTTCCACCTTCCACAGTGATTGG - Intergenic
1040331411 8:46387579-46387601 GCACCACGCTCCAAAGTCTTGGG - Intergenic
1041232730 8:55769881-55769903 CCTCCACCTTCCAAAGTGCTCGG + Intronic
1042823291 8:72955251-72955273 CATCCGCCTTCCAAAGTGCTGGG + Intergenic
1042946961 8:74164829-74164851 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1043415026 8:80039159-80039181 GATCTACCATCCAAATTGTTTGG + Intronic
1043440156 8:80269790-80269812 GTTCAGCCTTCCAAAGTGTTGGG - Intergenic
1043458223 8:80432929-80432951 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1044607580 8:94060596-94060618 CCTCCACCTCCCAAAGTGTTGGG + Intergenic
1045026741 8:98094455-98094477 GATCCGCCTCCCAAAGTGCTGGG + Intergenic
1045054174 8:98355029-98355051 GATCAACCTCCCAAAGTGCTGGG + Intergenic
1045142376 8:99300971-99300993 GAGCCACCCACCAAAGTGCTGGG - Intronic
1046000434 8:108414454-108414476 GTTCCACCTCCCGAAGTGTTGGG + Intronic
1046230553 8:111349995-111350017 CCTCCACCTTCCAAAGTGCTGGG - Intergenic
1046798581 8:118399132-118399154 CTTCCACCTCCCAAAGTGTTGGG + Intronic
1047117999 8:121867016-121867038 GATCCTCCTCCCAAAGTGCTAGG + Intergenic
1047751193 8:127881988-127882010 CCTCCACCTTCCAAAGTGCTAGG + Intergenic
1047786053 8:128154773-128154795 GCTCGACCTCCCAAAGTGTTGGG + Intergenic
1049701870 8:144018779-144018801 GCTCGGCCTTCCAAAGTGTTGGG - Intronic
1049743558 8:144252714-144252736 GGTCCACCTCCCAAAGTGTCGGG - Intronic
1050858878 9:10398126-10398148 CCTCCACCTTCCCAAGTGTTGGG - Intronic
1051381955 9:16468154-16468176 CCTCGACCCTCCAAAGTGCTAGG + Intronic
1051432928 9:16998898-16998920 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1051627195 9:19109715-19109737 GATCCACCTGCCAAAGTGTTGGG - Intronic
1052800750 9:32965801-32965823 CATCAGCCTTCCAAAGTGTTGGG - Intergenic
1053074976 9:35124994-35125016 GATCAGCCTCCCAAAGTGTTGGG + Intergenic
1053564052 9:39228785-39228807 GATCAACCTCCCAAAGTGCTGGG + Intronic
1053829839 9:42066667-42066689 GATCAACCTCCCAAAGTGCTGGG + Intronic
1054133096 9:61390249-61390271 GATCAACCTCCCAAAGTGCTGGG - Intergenic
1054600719 9:67120786-67120808 GATCAACCTCCCAAAGTGCTGGG - Intergenic
1054806569 9:69401508-69401530 GATCCACCTGCCAAAGTGCTGGG + Intergenic
1055167754 9:73218176-73218198 GCTTCAGCCTCCAAAGTGCTAGG + Intergenic
1055510794 9:76993962-76993984 GATCCACCTGCCAAAATGTTGGG + Intergenic
1055631282 9:78226482-78226504 CCTCCACCTTCCAAAGTGCTAGG - Intergenic
1056075091 9:83030114-83030136 GATCTACCCACCAAAGTGCTGGG - Intronic
1056516407 9:87355080-87355102 GATCCACCTCCCAAAGTGCTGGG + Intergenic
1056750535 9:89347720-89347742 GATGCACCTCCCAAAGTGCTGGG + Intronic
1057223766 9:93274270-93274292 GATCCACCCGCCAAAGTGCTGGG - Intronic
1057607722 9:96512572-96512594 CCTCGACCTTCCAAAGTGTTGGG + Intronic
1058097094 9:100874827-100874849 TATCCAGTCTCCAAAATGTTGGG - Intergenic
1058577228 9:106416603-106416625 GATGGAACCTCCACAGTGTTTGG + Intergenic
1058599594 9:106654766-106654788 GATCTACCATCTAAAATGTTGGG + Intergenic
1059113047 9:111575048-111575070 CCTCAACCTTCCAAAGTGTTGGG - Intronic
1059279464 9:113119947-113119969 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1059301059 9:113313917-113313939 GATCCGCCCGCCTAAGTGCTGGG - Exonic
1059763086 9:117357853-117357875 GTTCATCCCTCCAAAGGGTTAGG - Intronic
1060095525 9:120785777-120785799 GATCCACCCTCCAAAGTGTTGGG - Intronic
1060122451 9:121006590-121006612 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1060177438 9:121507471-121507493 GATCCTCCCGCCTAAGTGCTGGG + Intergenic
1060286553 9:122258687-122258709 GATCAGCCTCCCAAAGTGTTGGG - Intronic
1060697182 9:125719379-125719401 GATCCGCCTCCCAAATTGTTGGG - Intergenic
1060913990 9:127373771-127373793 CATCAACCTCCCAAAGTGTTGGG - Intronic
1060984487 9:127812021-127812043 GATCCTCCTGCCAAAGTGCTGGG - Intronic
1061097783 9:128469742-128469764 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1061124301 9:128664200-128664222 GATCAGCCTTCCAAAGTGCTGGG + Intergenic
1061126741 9:128681821-128681843 GCTTCAGCCTCCAAAGTGCTGGG - Intergenic
1061176404 9:129000205-129000227 GTTCAGCCTTCCAAAGTGTTGGG + Intronic
1061194320 9:129099372-129099394 GATCCGCCTCCCAAAGTGCTGGG + Intronic
1185596480 X:1309957-1309979 CAGCAATCCTCCAAAGTGTTAGG - Intronic
1185631291 X:1517495-1517517 GTTCCACCCTCCAGAGTCTCAGG + Intronic
1187053519 X:15717988-15718010 GATCCACCTCCCAAAGTGTTGGG - Intronic
1187199916 X:17125101-17125123 GATCCACCTCCCAAAGTGCTGGG + Intronic
1187251561 X:17603094-17603116 CTTTCACCTTCCAAAGTGTTGGG + Intronic
1187532513 X:20109793-20109815 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1187533982 X:20120923-20120945 CCTCCACCTCCCAAAGTGTTGGG - Intergenic
1187904306 X:24051784-24051806 GATCTGCCTTCCAAAGTGCTGGG - Intergenic
1189663790 X:43331693-43331715 GATCCTCCCTCCAAAGCCTCTGG + Intergenic
1190806134 X:53838958-53838980 CCTCAACCTTCCAAAGTGTTGGG + Intergenic
1190825386 X:54013565-54013587 CCTCCACCTCCCAAAGTGTTGGG - Intronic
1190853956 X:54274753-54274775 CATCAACCTCCCAAAGTGTTGGG - Intronic
1192235641 X:69293923-69293945 GAGCCACCCTCCACAGGCTTAGG - Intergenic
1192251050 X:69414022-69414044 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1192328913 X:70158591-70158613 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1192594656 X:72393952-72393974 GACCCACCCTGCAAAGTGGATGG + Intronic
1194594833 X:95844663-95844685 GCTCCACCTCCCAAAGTGTTGGG + Intergenic
1195137853 X:101928605-101928627 CCTCCGCCTTCCAAAGTGTTGGG + Intronic
1195840263 X:109168304-109168326 GATGCACCCTCCACAGTGACAGG - Intergenic
1196058764 X:111385403-111385425 CCTCCACCTTCCAAAGTGCTGGG - Intronic
1197256919 X:124273422-124273444 GATCCGCCTCCCAAAGTGCTGGG - Intronic
1197839303 X:130728347-130728369 AATCCACCCTCTATAGTGTCAGG - Intronic
1200795016 Y:7333025-7333047 CCTCGACCTTCCAAAGTGTTGGG + Intergenic
1200945960 Y:8837893-8837915 GATCCACCCCACAAAGTGCTGGG + Intergenic
1201059377 Y:10031671-10031693 GATCCGCCTCCCAAAGTGTTGGG - Intergenic
1201455128 Y:14160965-14160987 AATTGACCCTCAAAAGTGTTGGG - Intergenic
1201557579 Y:15280264-15280286 AATCAACCCTCCAAAGCATTGGG + Intergenic