ID: 1060097519

View in Genome Browser
Species Human (GRCh38)
Location 9:120805362-120805384
Sequence TCCTGATGTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060097515_1060097519 8 Left 1060097515 9:120805331-120805353 CCATAAGAGAAAGGAAAATTTGT No data
Right 1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060097519 Original CRISPR TCCTGATGTTGAGGGAGTGC TGG Intergenic
No off target data available for this crispr