ID: 1060099178

View in Genome Browser
Species Human (GRCh38)
Location 9:120823112-120823134
Sequence GTCTCAAGAATTTTAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060099177_1060099178 21 Left 1060099177 9:120823068-120823090 CCTGAAGTGCTGGGATTACAGGT 0: 1773
1: 79845
2: 309317
3: 282890
4: 292071
Right 1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG No data
1060099175_1060099178 24 Left 1060099175 9:120823065-120823087 CCTCCTGAAGTGCTGGGATTACA 0: 1600
1: 14886
2: 314561
3: 330818
4: 296990
Right 1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG No data
1060099173_1060099178 30 Left 1060099173 9:120823059-120823081 CCTTGGCCTCCTGAAGTGCTGGG 0: 557
1: 4994
2: 92324
3: 215416
4: 248940
Right 1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060099178 Original CRISPR GTCTCAAGAATTTTAATAAT TGG Intronic
No off target data available for this crispr