ID: 1060106979

View in Genome Browser
Species Human (GRCh38)
Location 9:120878659-120878681
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060106979_1060106990 13 Left 1060106979 9:120878659-120878681 CCTTCTGCCCCTTGATCCCCCTG 0: 1
1: 0
2: 7
3: 34
4: 363
Right 1060106990 9:120878695-120878717 CACTGCCCCATTCTGGATCCTGG No data
1060106979_1060106988 6 Left 1060106979 9:120878659-120878681 CCTTCTGCCCCTTGATCCCCCTG 0: 1
1: 0
2: 7
3: 34
4: 363
Right 1060106988 9:120878688-120878710 CCTGCCTCACTGCCCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060106979 Original CRISPR CAGGGGGATCAAGGGGCAGA AGG (reversed) Intronic
900615794 1:3565153-3565175 CAGGGGGTTCCAGGGTAAGAAGG - Intronic
901639291 1:10685333-10685355 CAGCGGGTTCATGGGGCAGGTGG - Intronic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
902037251 1:13466859-13466881 AAGGAGGACCAAGGGGCTGAAGG + Intergenic
902649826 1:17829843-17829865 CAGGGGCAGCCAGGTGCAGAGGG + Intergenic
902847856 1:19126354-19126376 CAGAGAGCTCAAGGGGCTGAGGG - Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
903178769 1:21595155-21595177 CAGGGGGACCAAGCGCCTGATGG - Intergenic
903834451 1:26193902-26193924 CAGGGGGAAGTAGGGGCAAAGGG - Intronic
905170386 1:36106496-36106518 CAGGGGGATGGGGGAGCAGATGG + Intronic
906069398 1:43006443-43006465 CAGGGCAATCCAGGGGCAGATGG - Intergenic
906235982 1:44210287-44210309 GAGGGGCACCAAGGGGGAGAAGG - Intergenic
907459123 1:54594743-54594765 CAGTGGGAGCCCGGGGCAGAGGG - Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
909404877 1:75276952-75276974 CAGGTGGGTCAAGGGGAAGCAGG + Intronic
910142157 1:84038021-84038043 AAGGGCCATCAAGTGGCAGAAGG + Intergenic
910230474 1:84981678-84981700 GTGGGGGATAAAGGGGCAGTAGG + Intronic
910758332 1:90713201-90713223 CAGGGGGCTTAAGGGGAGGATGG + Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911025990 1:93435604-93435626 CAGAGGGATCCAGGAACAGATGG - Intergenic
911102717 1:94106913-94106935 CAGAGGGCTCACAGGGCAGAAGG - Intronic
911857507 1:102898754-102898776 CAGGGGGAAGCAGGTGCAGAAGG - Exonic
912508324 1:110171846-110171868 CAGGGGAGTCAAGGGGGAGAAGG + Intronic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
913349016 1:117837578-117837600 CAGAGTGATCTAGGGGCAGAAGG - Intergenic
916849703 1:168690971-168690993 CTGGGGGACCAAGAGGCAAAGGG - Intergenic
917193404 1:172442574-172442596 CAAGGAGGTCAAGTGGCAGAAGG - Exonic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
919846659 1:201647252-201647274 GAGGGGGAACAAGAGCCAGATGG - Intronic
920292048 1:204929982-204930004 CATGGGGATCAGAGGGCAGGAGG + Intronic
920336217 1:205247081-205247103 CAGGGTGATCATGGGGGAAATGG + Intronic
921232195 1:213084177-213084199 CTGGGGGAGAAAGGGGAAGAGGG - Intronic
922447401 1:225709047-225709069 CAGAGGAATAAAGGGGAAGATGG + Intergenic
922691196 1:227693011-227693033 CAGGGAGCTGATGGGGCAGAAGG - Intergenic
922752659 1:228077928-228077950 CGGGGGGATCCTGGGGGAGAGGG - Intergenic
923625032 1:235606792-235606814 CAGGGGGAGCATGGGTCAGAAGG + Intronic
923752891 1:236762916-236762938 TAGGAGGATCTAGGGACAGAAGG + Exonic
924788147 1:247219423-247219445 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
924805026 1:247355101-247355123 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
1062909993 10:1206004-1206026 CAGGTGGTTCACGGGGCAGCTGG + Intronic
1063124138 10:3124955-3124977 CATGCGGGTCAAGGGGCCGAGGG - Intronic
1063814933 10:9760593-9760615 TAGTGGGAGCAAGGGGCAGAGGG + Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1069275819 10:66589229-66589251 GAGGGGGATCAAGGAGAAGATGG + Intronic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1070163336 10:73879505-73879527 CAGAGGGGTCAAGAGGCAGAGGG - Intergenic
1070987671 10:80702239-80702261 CATGGGGACCAAGCGGCAGCCGG - Intergenic
1071080747 10:81806999-81807021 TAGGGGGATCCAGGCACAGACGG + Intergenic
1072542186 10:96406640-96406662 CAGAGGGGTCATGGGGCACAAGG - Intronic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1073300347 10:102467549-102467571 CAGGGGGTTCAAGGGCCTCAGGG + Intronic
1073429410 10:103476566-103476588 GAGGGGGGTCAAGGGGCAGCTGG + Intronic
1075441681 10:122484870-122484892 CAAGGGGTTCAGGGGACAGAGGG - Intronic
1075918035 10:126186562-126186584 CATGGGGATGAATGGGAAGATGG + Intronic
1076316575 10:129546230-129546252 CAGGGGCAGACAGGGGCAGACGG + Intronic
1076594593 10:131617837-131617859 CCAGGGGGTCAAGGGGCTGAAGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076783412 10:132736917-132736939 CTGAGGGATCAGGGGGCAGAGGG - Intronic
1077101463 11:824350-824372 CCGGTGGATGAAGGAGCAGACGG + Exonic
1077302175 11:1852429-1852451 CACGGAGAGCAAGGGGCAGCGGG + Intergenic
1077365715 11:2160757-2160779 CAGGGGCAGCAATGGGCAGTTGG + Intronic
1079145508 11:17847670-17847692 CAGGGGGAGCAAGGGACAGAAGG + Intronic
1079467265 11:20742821-20742843 TAGGGATATCAAGGGGCAGAAGG - Intronic
1080835278 11:35935026-35935048 CAGGGAGCTCCAGGGGCAGCTGG + Intergenic
1081888666 11:46521432-46521454 CCAGGGGATGAAGGGGCAGGAGG + Intronic
1082744966 11:56951208-56951230 CAGAAAGATCAAGGGGCAGCAGG + Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083429288 11:62605613-62605635 ATGGGGGATCCAGGGGCACAGGG + Intronic
1084025011 11:66442586-66442608 CAGGAAGATCAAGGGGCAGCAGG - Intronic
1085018049 11:73188287-73188309 AAGGGGGATCGATGGGCAGGAGG - Intergenic
1085021578 11:73213450-73213472 CAGGAGGAGCTAGGGGGAGATGG + Intergenic
1085940105 11:81198164-81198186 CAAGAAGATCAAGGGGCAGCAGG + Intergenic
1085959998 11:81450503-81450525 CAGGAGGAACAAGAGGGAGAGGG + Intergenic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089614364 11:119686923-119686945 CAGGGGGCCCAAGTGGCAGGTGG + Intronic
1091590257 12:1838490-1838512 CAGGGAGAGGAAGTGGCAGAAGG + Intronic
1091916129 12:4272777-4272799 CAGGGGGAGCGAGGGGGAGCCGG + Intergenic
1092297577 12:7212832-7212854 CTGGGGGATCACGAGGCAGCTGG + Intronic
1094018704 12:25891469-25891491 CAGGTGGACAAAGGAGCAGAAGG - Intergenic
1095601780 12:44021691-44021713 TAGAGGGATCAAAGGGCAGCAGG - Intronic
1097277943 12:57825869-57825891 CAGGGGGAGCATGGGCAAGAGGG + Intronic
1098777640 12:74641654-74641676 CAGTGGTGTCATGGGGCAGAGGG - Intergenic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102660026 12:114518341-114518363 GAGGGGGTTCAAGAGGCACATGG - Intergenic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103846932 12:123908294-123908316 GAGGGGGATGGAGGGACAGAGGG - Intronic
1105412694 13:20184641-20184663 CAGGGCGAGAAAGGGGGAGATGG - Intergenic
1106196405 13:27497894-27497916 CAAGGGAAGCAAGGGGTAGAAGG - Intergenic
1107015630 13:35706197-35706219 CAGGGTGAGCTAGGTGCAGAAGG + Intergenic
1107372271 13:39766129-39766151 CAGGCAGATGGAGGGGCAGATGG - Intronic
1108129011 13:47276917-47276939 GAGCGGGAGCAAGAGGCAGAGGG + Intergenic
1109798705 13:67347219-67347241 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1110346748 13:74457255-74457277 AAGGGGGATTAAGGGGAAAATGG + Intergenic
1110898389 13:80786933-80786955 CAAGTGGAGCAAGGGGCAGTGGG + Intergenic
1112701890 13:102019483-102019505 CAGGGGTATCCAGGGACAGATGG - Intronic
1113413868 13:110113085-110113107 CAAGTGGGTCAAGGGGCAGAGGG + Intergenic
1113421514 13:110174730-110174752 CAGGGAGATCAAGGGATAGCGGG - Exonic
1113520127 13:110934631-110934653 CAGGGAGATCAGGGGACAGCAGG + Intergenic
1113811393 13:113144504-113144526 CAGGGGCATCAGCGGGCAGGAGG + Intronic
1113971582 13:114195341-114195363 GAGGTGGAGAAAGGGGCAGATGG - Intergenic
1114185048 14:20394719-20394741 CAGGTGGATCACGAGGCAGGTGG - Intronic
1114460734 14:22884739-22884761 CTGGGGGCCCCAGGGGCAGAGGG - Exonic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1116986521 14:51225430-51225452 CAGGGGCAGTAAGGGGCAAATGG + Intergenic
1117326039 14:54669929-54669951 CAGGGGGCTGGGGGGGCAGAAGG - Intronic
1117718118 14:58601442-58601464 CAGTGGCATCAACTGGCAGATGG - Intergenic
1118299675 14:64603996-64604018 CAAGGGGATAAAGGGCTAGAAGG + Intergenic
1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG + Intergenic
1119668898 14:76504009-76504031 CCTGGGGAACAAGGGGCACAAGG + Intergenic
1120050648 14:79861768-79861790 CAGGAGGATCAAGATGCAGAGGG - Exonic
1120743567 14:88133635-88133657 CAGAGGGATCAAGGTACACAGGG - Intergenic
1121713935 14:96059502-96059524 CACAGGGAGCAAGTGGCAGAGGG + Intronic
1122180420 14:99950468-99950490 CATGGGCGTCAAGGGGCAGCTGG - Intergenic
1122464044 14:101918445-101918467 GAGGGGGATGAAGGGGGTGAGGG - Intronic
1122464128 14:101918628-101918650 GAGGGGGGTCAGGGGGGAGAGGG - Intronic
1122484038 14:102066176-102066198 CAGGGGGATGGAGGAGCAGCGGG - Intergenic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1123049512 14:105534090-105534112 TAGGGGGATGAAGGGGGACACGG - Intergenic
1123202934 14:106683956-106683978 CATGAGTATCAAGGGGGAGATGG - Intergenic
1123578442 15:21695402-21695424 CAGGGGGATGAAGGGAGAGGCGG + Intergenic
1123615067 15:22137884-22137906 CAGGGGGATGAAGGGAGAGGCGG + Intergenic
1125753768 15:42048589-42048611 CATGGGGATGACGGGGCGGAGGG + Intronic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127113738 15:55702841-55702863 CACTGGCATCAAGAGGCAGAGGG - Intronic
1127291138 15:57572355-57572377 AATGGGGATCAAGGGGCAAGAGG + Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129367414 15:75064845-75064867 CAGGAAGATCAAGGGGCAGCAGG + Intronic
1129539077 15:76336627-76336649 GATGGGGATCCAGGGGCTGATGG - Intergenic
1129663374 15:77565742-77565764 CAGCGGGGTCAGGGTGCAGAGGG - Intergenic
1129696461 15:77743151-77743173 CAGGGGGAGCATGGGGTAGGGGG - Intronic
1129770979 15:78203521-78203543 CAGAGGGAGGAAGCGGCAGAGGG - Intronic
1129947766 15:79556151-79556173 CAGAGGGGTCATGGGGCACAAGG - Intergenic
1130094788 15:80847852-80847874 CAGGAGGAGCCAGGAGCAGAAGG + Intronic
1130186646 15:81689779-81689801 TTGGGGGATCAAGTGGCAGCAGG + Intergenic
1130552107 15:84895870-84895892 CAGGGGGATGCAGGGGTACAGGG + Intronic
1130559677 15:84948132-84948154 CATGGGAAGAAAGGGGCAGAAGG - Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1131513861 15:93064825-93064847 CATGGTGAGCAAGAGGCAGAGGG + Intronic
1202987312 15_KI270727v1_random:429647-429669 CAGGGGGATGAAGGGAGAGGCGG + Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1133747201 16:8696279-8696301 CAGGGGGACCCTGGGGAAGAAGG + Intronic
1134244739 16:12531527-12531549 CATGAGGACCACGGGGCAGATGG - Intronic
1134543997 16:15093855-15093877 AAGAGGGGTCAAGGCGCAGAAGG + Intronic
1134619232 16:15675116-15675138 CAAGGTGCTCAAGGGGCAGGAGG + Intronic
1135150670 16:20002528-20002550 GAGAGGGATCAAAGGGCAGCAGG + Intergenic
1135186504 16:20320414-20320436 CAGGGAGATCAAGGTGAAGGTGG - Exonic
1135361571 16:21820005-21820027 AAGAGGGGTCAAGGCGCAGAAGG + Intergenic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1136260966 16:29075389-29075411 AAGAGGGGTCAAGGCGCAGAAGG - Intergenic
1136505046 16:30697987-30698009 CAGGTAGATCTAGGGGCAAACGG + Intergenic
1137405899 16:48189171-48189193 CAGAGGAATCAAAGGGCAAAAGG + Intronic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1140657478 16:77155480-77155502 CAGCTGGATCAGGGGCCAGAGGG + Intergenic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1141627053 16:85266898-85266920 ATGGGGGACCAAGGGGGAGAGGG - Intergenic
1142197755 16:88746538-88746560 CAAGGGGACCAAGGCTCAGATGG + Intronic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1144131458 17:12250971-12250993 CAGGTGGGTCAGGAGGCAGAGGG + Intergenic
1144560263 17:16315469-16315491 CAGGGGGACCAAGGGGCCACTGG - Intronic
1144797610 17:17903007-17903029 CAGGTGGATGAAGGGGAGGAAGG - Intronic
1145031405 17:19507630-19507652 CAGGGGGACCCCGGGGTAGAAGG - Intronic
1145262000 17:21360072-21360094 CAGGGTCATCATGGGGCAGCAGG - Intergenic
1145262956 17:21365567-21365589 CAGGGGAATCCAGGGGTGGATGG - Intergenic
1146450020 17:32965410-32965432 CAGGAAGATCAAGGGGCAGGAGG + Intergenic
1146461457 17:33049035-33049057 CAGAGGCAGGAAGGGGCAGATGG + Intronic
1146952035 17:36913479-36913501 TAGGGAGAGCCAGGGGCAGAAGG - Intergenic
1147189093 17:38728707-38728729 CAGGGGAACCAAGGGCCAGGAGG - Exonic
1148213576 17:45822428-45822450 GACGGGGGTCAAAGGGCAGAAGG + Intronic
1148717323 17:49725045-49725067 CCGTGGGATGAAGGGTCAGATGG - Intronic
1149301461 17:55308026-55308048 CAGGGGACGCAAGGAGCAGAAGG + Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1152626364 17:81389540-81389562 CAGGGGGCTGGAGGGGCAGCAGG + Intergenic
1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG + Intergenic
1153474018 18:5477360-5477382 CAGTGGAATGAAGGGGGAGAGGG + Intronic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1155606448 18:27611743-27611765 GAGGGGGATAAAGGAGCACAGGG + Intergenic
1156463586 18:37335032-37335054 ACGGGAGAGCAAGGGGCAGAGGG - Intronic
1156483276 18:37449321-37449343 CAGCGGGATCATGGGGGACAGGG + Intronic
1157604961 18:48920617-48920639 CAGGGAGATCCAGGAGCAGATGG + Exonic
1158446192 18:57523706-57523728 CAGGAGCAGCAAGAGGCAGATGG + Intergenic
1160310489 18:77785639-77785661 CAGGGGTCTCCAGGGGGAGATGG - Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1161156201 19:2732970-2732992 CAGGGGGATCATGGCGCTTACGG + Exonic
1161772857 19:6240728-6240750 CAGGAGAATTCAGGGGCAGAGGG + Intronic
1161984479 19:7646202-7646224 CAGGGGGATTGAGGGGAAGGAGG - Intronic
1162895443 19:13762646-13762668 GAGGCGGATCCGGGGGCAGAGGG - Exonic
1163692757 19:18746172-18746194 TTGGGGGCTCAAGGGGCACAGGG + Intronic
1165113553 19:33515436-33515458 CATTGGGATGAAAGGGCAGAGGG + Intronic
1165257993 19:34591644-34591666 CAGCTGGAACAAGGGGCAGCAGG - Intergenic
1165278388 19:34774288-34774310 CTGGGGGCTGGAGGGGCAGATGG - Intergenic
1165311496 19:35031319-35031341 CATGGGGGTCAAGGGGGAGACGG + Intronic
1166109500 19:40613641-40613663 CAGCAGGATCAGGGGGCAGCTGG + Intronic
1166213505 19:41321750-41321772 CAGCAGCACCAAGGGGCAGAAGG + Intronic
1166502826 19:43354031-43354053 CACAGGGATCAAGGGACTGAGGG - Intronic
1166563903 19:43751692-43751714 CACTGGGAGGAAGGGGCAGAAGG - Intronic
1166975789 19:46604279-46604301 CAGGTGGATCAAGAGGCTCATGG + Intronic
1167041831 19:47027312-47027334 GAGGGGGATCCAGGGGCAGAAGG - Intronic
1167080945 19:47275633-47275655 CAGGGAGGTGAAGAGGCAGATGG - Exonic
1167580263 19:50337187-50337209 CAGAAGGTTAAAGGGGCAGAAGG - Intronic
1168069345 19:53941275-53941297 TAGGGGGATAAAGGGGGAGGTGG + Intronic
1168199630 19:54805293-54805315 CAGGGGACTGAAGGGGAAGATGG + Intronic
925021814 2:575578-575600 CAGGGTGTGCAAGGGCCAGAAGG + Intergenic
926936118 2:18087959-18087981 CAGGGAGATCAGGGGGCAACAGG - Intronic
927871887 2:26629134-26629156 CAGGTGGGGCCAGGGGCAGATGG - Intronic
928459440 2:31456963-31456985 CTGAGGGATCCAGAGGCAGATGG - Intergenic
929426782 2:41851851-41851873 GTGGGTGAGCAAGGGGCAGAGGG + Intergenic
930008273 2:46915361-46915383 GAGAGGGAACAAGGAGCAGAGGG + Intronic
930149821 2:48047419-48047441 AAGGAGGATCCAGGGGAAGATGG - Intergenic
930542515 2:52724678-52724700 CAAGGGGATTAGTGGGCAGAAGG - Intergenic
930899140 2:56482353-56482375 CAGGGTGGTCAAGGGGTAGGTGG - Intergenic
931434776 2:62236704-62236726 CAGTGGGGTCAAAGGGCAAAAGG - Intergenic
932583091 2:73005269-73005291 CAGGGGGCTGGAGCGGCAGAGGG - Intronic
933653001 2:84864372-84864394 CAGGGTGATCCAGTGGCAGTGGG - Intronic
934777388 2:96948207-96948229 CACAGGGAGCGAGGGGCAGAGGG - Intronic
935206088 2:100897484-100897506 GAGGTGGAGCCAGGGGCAGAGGG - Intronic
935320547 2:101884033-101884055 CAGGGGGAGCAAGAGGCAGACGG + Intronic
935351629 2:102155798-102155820 CAGTGTGCTCAAGGGGCACAAGG - Intronic
935386911 2:102509417-102509439 AAGGAGGATTAAGTGGCAGATGG - Intronic
935454130 2:103246023-103246045 CTGGTGGATAATGGGGCAGATGG - Intergenic
936152630 2:110030045-110030067 CCGGGGGAGCAGGGGCCAGAGGG + Intergenic
936192050 2:110341367-110341389 CCGGGGGAGCAGGGGCCAGAGGG - Intergenic
938114250 2:128592429-128592451 CAGGGGGAGCAAGGGAATGAGGG + Intergenic
938308273 2:130268824-130268846 CAGGGGGCTCAAGGTCCAAATGG + Intergenic
938447056 2:131388012-131388034 CAGGGGGCTCAAGGTCCAAATGG - Intergenic
938572368 2:132572227-132572249 CAGACGGAAGAAGGGGCAGAGGG - Intronic
938710293 2:133970788-133970810 TAGGGGGATTAAGAGGGAGAAGG - Intergenic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
943721411 2:191206834-191206856 CAGCGAGGTCAAGTGGCAGAAGG - Intergenic
943953867 2:194161852-194161874 CAGGAAGATCAAGGGGAAGCAGG - Intergenic
944176096 2:196830798-196830820 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947133551 2:226954655-226954677 CAGAGGGATAAATAGGCAGATGG + Intronic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947347538 2:229208784-229208806 CAGGAGGAGAAAGGGGAAGAGGG + Intronic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947832008 2:233148175-233148197 CAAGGGGATCCAGGGCCAGCAGG + Intronic
948575467 2:238946912-238946934 GAGGGGGCTGAAGGGGCAGGGGG + Intergenic
948728491 2:239948965-239948987 TTGGGGGCTCCAGGGGCAGAAGG - Intronic
948925829 2:241096675-241096697 CAGGAGGGAGAAGGGGCAGAAGG + Intronic
1168844173 20:932110-932132 CAAGGGGATCAAGAAGCAGTAGG + Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1171276159 20:23858069-23858091 CTGGGGGATGGAGGGGCAGGGGG - Intergenic
1171285949 20:23938210-23938232 GAGGGGGCTGAAGTGGCAGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172709731 20:36912256-36912278 GAAGTGGATAAAGGGGCAGATGG - Intronic
1172909172 20:38393734-38393756 CAGGGTGCTCAAGGGCCAAAGGG + Intergenic
1173690000 20:44953267-44953289 CAGTGGGATCAGGAGCCAGAGGG - Intronic
1173841090 20:46157737-46157759 CAGGGGGAGGAAGAGGCAGTGGG + Intergenic
1174083164 20:47985124-47985146 TAGGGAGGTCAAGAGGCAGAGGG - Intergenic
1174451589 20:50624192-50624214 CAGGGAGGGCAAGGGGAAGAGGG - Intronic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175220591 20:57414386-57414408 CAGGGCCAACAAGGGGCAGCAGG + Intergenic
1175373419 20:58508350-58508372 CATGGGGATCAAGGAGCACAGGG + Intronic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1175841069 20:62027878-62027900 GAGAGGGGTCAAGGGGCAGGCGG - Intronic
1176993184 21:15522429-15522451 GAGGGGGCTGAAGGGGCAGGGGG + Intergenic
1178697218 21:34803719-34803741 AATGGGGATCAAGGAGTAGAAGG - Intronic
1178997403 21:37416104-37416126 CAGGGAAAGCAAGGGTCAGAAGG - Intronic
1179966241 21:44807789-44807811 CAGGTGGACCGAGAGGCAGAGGG - Intronic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180939055 22:19645009-19645031 CAGGCTGATCAAGCGGCAGTTGG - Intergenic
1182114155 22:27745402-27745424 CTGGGGGAACGAGGGGCAGAAGG - Intergenic
1182146162 22:27998110-27998132 CAGGGGTAACAAGGGGATGATGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183270311 22:36858196-36858218 CAGGGGGAGAATGAGGCAGAGGG - Intergenic
1183298065 22:37043743-37043765 AGGGGGGATCAAAGGGTAGAAGG + Intergenic
1183933915 22:41250956-41250978 CACGAGCATCAAGGGACAGAGGG + Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184264942 22:43341973-43341995 AAGGGGGATGATGGGGCAGCAGG + Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
949371889 3:3344170-3344192 CAGGATGAGCAAGGGGTAGAGGG - Intergenic
949555434 3:5148477-5148499 CAGGAAAATCAAGGGGCAGCAGG - Intronic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
952575356 3:34767929-34767951 CAGGTTTATCAAAGGGCAGATGG - Intergenic
952749281 3:36812329-36812351 CAGGCTGATCATGAGGCAGAGGG + Intergenic
953161777 3:40427352-40427374 CAGGTGGTTCTATGGGCAGACGG - Exonic
954801697 3:53190718-53190740 GAGGGGAATCAAAGGACAGAAGG - Intronic
954805664 3:53218538-53218560 CAGGGAGATCAAGAGGCAACTGG + Intergenic
955317553 3:57951488-57951510 CTGGGGAATCAAAGGGCAAAAGG + Intergenic
955695580 3:61632789-61632811 GAGGGGGATGAAGGGGATGAAGG - Intronic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
961966010 3:130903634-130903656 AGGGGGGAGGAAGGGGCAGAAGG - Intronic
962257672 3:133883593-133883615 CAGGGGAAGCAAGGGGCACTGGG - Intronic
962650140 3:137480210-137480232 CCAGGGGATCTAGGGGCACAGGG - Intergenic
962924471 3:139978874-139978896 CAAGTGGAACATGGGGCAGAGGG + Intronic
963090436 3:141478554-141478576 CAGGGGCATCAAGTGGGAGCAGG + Intergenic
963234945 3:142947316-142947338 CAGGAGGAGGAAGGGGCAGGCGG + Intergenic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
964808174 3:160634438-160634460 CAGGGGGATGTCAGGGCAGAGGG - Intergenic
966879374 3:184341333-184341355 GAGGAGGAGCAAGGGGCAGAGGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
968658563 4:1789332-1789354 CAGGGGGTCCCATGGGCAGAAGG + Intergenic
969697084 4:8740999-8741021 CACGGGGATCAGGTTGCAGAGGG - Intergenic
971268230 4:25113340-25113362 ATGGGGGAGCAAGGGGCACAGGG - Intergenic
972555042 4:40173147-40173169 CAAGGGGTTCAAGGGGAAGTTGG - Intergenic
978875144 4:113631705-113631727 CAGGGAGATCAATGAGCACAGGG + Intronic
979733397 4:124052491-124052513 AAGGCTGATCAAGGGGCTGAGGG + Intergenic
980070681 4:128240541-128240563 CTGGAGGATGAAGGGGCACAAGG - Intergenic
980522827 4:133954183-133954205 CAGGAAGATCAGGGGGCAAAAGG - Intergenic
981148248 4:141350678-141350700 CAGGGGGTGCAAGGGAAAGAAGG - Intergenic
983160010 4:164401309-164401331 GAGGGAGATCAAGGTGGAGATGG - Intergenic
985717655 5:1471695-1471717 CAGGAGCATCCAGGGGTAGAGGG + Intronic
988030388 5:25756329-25756351 CTGGGGGATCAAGAAGCAGTAGG + Intergenic
990676889 5:58196692-58196714 GAGGCTGATCAAGGGGCAGGAGG - Intergenic
991565273 5:67998283-67998305 CAGGGGTATCAAAGGGCAAAGGG + Intergenic
992965079 5:81991496-81991518 CAGGAGCAAAAAGGGGCAGAGGG - Intronic
993843420 5:92909458-92909480 CAGGAGAATCAAGGAGCAGGTGG + Intergenic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
996553592 5:124755053-124755075 CAGGAAGATCAAGAGGCAGCAGG + Intergenic
996993610 5:129667600-129667622 GAGAGGGAGCAAGGGGCAGGAGG - Intronic
997064898 5:130548737-130548759 AAGGAAGATCAAGGGGCAGCAGG - Intergenic
998368762 5:141647891-141647913 CATGGGGATCAAGAAGCAGGGGG + Intronic
998414828 5:141938575-141938597 CAGGGTGTTCAAGCTGCAGAGGG - Exonic
998964602 5:147525491-147525513 CAGGGAGGTCCAGGAGCAGAGGG + Intergenic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
1001665981 5:173434089-173434111 CATGGGGGTCCAGGGGCAGGAGG - Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1005348009 6:24909452-24909474 CTGGAGGAGCAAGGGGAAGAGGG + Intronic
1005869372 6:29962813-29962835 CAGGGAGATCAGGGGGCAAAAGG + Intergenic
1006002734 6:30978300-30978322 AAGGGGGATCATGGAGGAGAAGG + Intergenic
1006296946 6:33173968-33173990 CAGGTGGCTCAAGGTCCAGAGGG - Intronic
1006599512 6:35216137-35216159 GAGGGGGGCCCAGGGGCAGATGG + Intronic
1007582204 6:42966303-42966325 CAGGGGGCCCATGGAGCAGAAGG + Exonic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008489214 6:52067909-52067931 GAGGGGCTTGAAGGGGCAGAGGG + Intronic
1009282980 6:61775289-61775311 CAGGGCAATCAAGCAGCAGAAGG + Intronic
1009978551 6:70700155-70700177 GAGAAGGAGCAAGGGGCAGAGGG - Intronic
1011204045 6:84872326-84872348 AAGGTGGACCCAGGGGCAGAGGG + Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1015312690 6:131782687-131782709 CAAGGGGATCAAGAGGCTCATGG + Intergenic
1015583505 6:134751872-134751894 AAGGGAGATCAAGGAGAAGAAGG - Intergenic
1016732535 6:147442328-147442350 CAGGACAAACAAGGGGCAGAAGG + Intergenic
1017712478 6:157182847-157182869 CAGGGGAGTCCAGGGGCAGAAGG - Intronic
1017943346 6:159073140-159073162 CAGAGGGAGCAAGGGACATACGG - Intergenic
1018415820 6:163601304-163601326 CAGGTGTCTCAATGGGCAGATGG - Intergenic
1019006271 6:168799253-168799275 CCGGGGGATAGAGGGGCAGGTGG - Intergenic
1019190488 6:170247964-170247986 CAGGGAGATGAAGGGGCATCTGG + Intergenic
1019660130 7:2219589-2219611 CAGAGGAATAAGGGGGCAGAGGG + Intronic
1021022026 7:15612569-15612591 CAGGCGGATGAAGTGGAAGAGGG - Exonic
1021095122 7:16527067-16527089 CAGGGGGCCAAAGGGGCTGATGG - Intronic
1021517925 7:21507425-21507447 CAGGAAAATCAAGGGGCAGCAGG - Intronic
1021522935 7:21554967-21554989 CAGGAAAATCAAGGGGCAGCAGG - Intronic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1022751316 7:33229392-33229414 CAGTGGTTTCCAGGGGCAGATGG - Intronic
1023965333 7:44961023-44961045 GAGGGGGCTGAAGGGGCTGAGGG + Intergenic
1024670559 7:51589990-51590012 CAGGGCCATCCAGAGGCAGAGGG - Intergenic
1027736193 7:81935900-81935922 CAGAGGGACAAAGGGACAGAAGG - Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029325735 7:99807448-99807470 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1030080887 7:105776741-105776763 CAGGTGGATAAACAGGCAGAAGG - Intronic
1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG + Intronic
1033283064 7:140019286-140019308 AAGTGAGGTCAAGGGGCAGACGG + Intronic
1035808492 8:2472286-2472308 CAGGAGGAACCAGGGGAAGATGG - Intergenic
1036085212 8:5606244-5606266 CAGGAGCAGCATGGGGCAGAAGG - Intergenic
1036747422 8:11419870-11419892 CAGTTGGATGAAGAGGCAGAGGG - Intronic
1039182746 8:34884732-34884754 GAGGGAGAGCAAGGGGGAGATGG + Intergenic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1047255294 8:123209288-123209310 CAGAGGGATGGATGGGCAGAGGG - Exonic
1047504775 8:125470393-125470415 CAGGGAGATCCAGGGCCAGCAGG + Intergenic
1048524236 8:135186749-135186771 CAGGTGGTCCAAGAGGCAGATGG + Intergenic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1049822707 8:144645828-144645850 CAGGGGGAGCTGGGGGCAGCAGG + Intergenic
1050388543 9:5113568-5113590 GCAGGGGATCAAGGGGAAGATGG - Intronic
1050412959 9:5385437-5385459 CAGGAGGATCACGAGGCAGGAGG - Intronic
1050615400 9:7396672-7396694 AAAGGGGATAAAGTGGCAGAAGG - Intergenic
1053180056 9:35961004-35961026 TAGGGAGAGCAAGGGGAAGAGGG + Intergenic
1053582785 9:39424600-39424622 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1053846969 9:42249465-42249487 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1054104364 9:60983343-60983365 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1054581980 9:66923507-66923529 AAGGGGGAGGAAGGGGCAGTGGG + Intronic
1057416320 9:94866168-94866190 CATGTGGCTCAAGGGGGAGATGG + Intronic
1058429470 9:104905197-104905219 CATGAGGAACAAGGAGCAGAAGG + Intronic
1058946032 9:109857137-109857159 CAGGAGGAGGAAGGGGCAGAAGG - Intronic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060827042 9:126693467-126693489 CAGGGGCAGCAACGGGGAGATGG - Intronic
1060881237 9:127119662-127119684 CTGGGGGATGGAGGGCCAGATGG + Intronic
1061180557 9:129022842-129022864 CAGGGGGCTCCATGGGCAGCTGG + Intronic
1061250163 9:129421792-129421814 AAGGGAGAGCAAGGGGCAGGGGG + Intergenic
1061721912 9:132557167-132557189 CAGGGGCTCCAAGGTGCAGACGG + Intronic
1061772033 9:132932664-132932686 CAGAGGAATGAAGAGGCAGAGGG - Intronic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1062567118 9:137168311-137168333 GTGTGGGGTCAAGGGGCAGACGG - Exonic
1186427796 X:9477983-9478005 CCTGGGGATGAAGGGGCGGAAGG - Intronic
1186477003 X:9865484-9865506 AAGGGGGAGCAAAGGGCAAATGG - Intronic
1186542563 X:10415661-10415683 CAGGGGAATCAAGGTGCTGTCGG + Intergenic
1187832369 X:23395384-23395406 CAGGGAGATAAAGGGCCAAAAGG + Exonic
1192362555 X:70448843-70448865 CAGGTTGACTAAGGGGCAGATGG + Intronic
1192587412 X:72329899-72329921 AAGGGGCATCAAGTGGCAGCTGG - Exonic
1194665207 X:96670428-96670450 CAGGTGGGTCAAGGCACAGAGGG - Intergenic
1195994044 X:110713516-110713538 CAGGGGAGTAAAGGGGAAGACGG - Intronic
1196017343 X:110954047-110954069 CAGTGAGATCAAGGGGAAGTGGG - Intronic
1196322849 X:114363162-114363184 GAGGGGGACCAAGGGGAAGTAGG + Intergenic
1202181147 Y:22140982-22141004 CAGGGATATCAAGGAGCACAAGG - Intergenic
1202210213 Y:22445418-22445440 CAGGGATATCAAGGAGCACAAGG + Intergenic
1202373802 Y:24215409-24215431 CAGGGGGCCTAAGGGGCAGTAGG - Intergenic
1202496979 Y:25454711-25454733 CAGGGGGCCTAAGGGGCAGTAGG + Intergenic