ID: 1060106979

View in Genome Browser
Species Human (GRCh38)
Location 9:120878659-120878681
Sequence CAGGGGGATCAAGGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060106979_1060106990 13 Left 1060106979 9:120878659-120878681 CCTTCTGCCCCTTGATCCCCCTG No data
Right 1060106990 9:120878695-120878717 CACTGCCCCATTCTGGATCCTGG No data
1060106979_1060106988 6 Left 1060106979 9:120878659-120878681 CCTTCTGCCCCTTGATCCCCCTG No data
Right 1060106988 9:120878688-120878710 CCTGCCTCACTGCCCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060106979 Original CRISPR CAGGGGGATCAAGGGGCAGA AGG (reversed) Intronic