ID: 1060107922

View in Genome Browser
Species Human (GRCh38)
Location 9:120885848-120885870
Sequence ACTTAGGTATTCCTCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060107922_1060107928 11 Left 1060107922 9:120885848-120885870 CCTGGGTGGAGGAATACCTAAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1060107928 9:120885882-120885904 CCTCTTTCAGCTTGGAGAAGCGG No data
1060107922_1060107926 3 Left 1060107922 9:120885848-120885870 CCTGGGTGGAGGAATACCTAAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1060107926 9:120885874-120885896 CTTCAGGACCTCTTTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060107922 Original CRISPR ACTTAGGTATTCCTCCACCC AGG (reversed) Intronic
900033813 1:390537-390559 ACATAGGTGGTTCTCCACCCAGG + Intergenic
900054648 1:620427-620449 ACATAGGTGGTTCTCCACCCAGG + Intergenic
900106620 1:984188-984210 ACTGGGTTATTCCTCCTCCCTGG - Intergenic
900239895 1:1611151-1611173 ACCTAGGAATGCCTGCACCCAGG + Intergenic
900688485 1:3964910-3964932 ACAAAAGTATTCCACCACCCAGG - Intergenic
905109772 1:35586833-35586855 ACTTTTGTATTCCTCAGCCCTGG + Intronic
906392099 1:45427008-45427030 CCTCAGGTAATCCTCCACCTCGG - Intronic
908655749 1:66386267-66386289 ACTTTGGTATTTCTCCCCACTGG - Intergenic
914846405 1:151286140-151286162 ACTTAGGTACACCTCCGCCACGG - Intronic
916421073 1:164638323-164638345 ACTTGTGTATTTTTCCACCCTGG - Intronic
922256169 1:223894693-223894715 ACATAGGTGGTTCTCCACCCAGG + Intergenic
924159301 1:241213996-241214018 ACTCAAGTAATCCTCCCCCCGGG + Intronic
1065650355 10:27882338-27882360 AGATAGGTAATCCTCTACCCTGG - Intronic
1067759180 10:49030343-49030365 ACTTAGGTGTGCCTTGACCCAGG + Intronic
1069543983 10:69316186-69316208 ACTTATCTCTTCCTCCACTCTGG - Intronic
1069548580 10:69346298-69346320 ACTTAGGCATTGCTCCACCATGG - Intronic
1079932941 11:26587544-26587566 ACTTAGGTTTGCAACCACCCTGG + Intronic
1082247648 11:49942854-49942876 ACATAGGTATAGCTCCACCATGG + Intergenic
1082790343 11:57342645-57342667 ATTTAGGAATACCTCCTCCCTGG + Intronic
1082806466 11:57454798-57454820 ACTTAGGTTATCCTGGACCCTGG - Intergenic
1083829275 11:65221042-65221064 GCTGGGGTATTCCTTCACCCTGG + Intergenic
1087555923 11:99720922-99720944 ACTTAGGTATACATCTAACCAGG + Intronic
1090531480 11:127595452-127595474 ATCTTGGCATTCCTCCACCCTGG - Intergenic
1092192749 12:6532908-6532930 ACTCAGCTATTCCTGCAACCAGG - Intergenic
1092360842 12:7834846-7834868 GCTTAGATAGTCCTTCACCCTGG + Intronic
1092373977 12:7940001-7940023 GCTTAGATAGTCCTTCACCCTGG + Intergenic
1104557538 12:129814783-129814805 ACTGAGCTTTTCCTCCTCCCAGG + Intronic
1108144308 13:47460842-47460864 AATTGGGAATTCCACCACCCTGG + Intergenic
1108353898 13:49612794-49612816 CCTTAGGTGATCCTCCACCTTGG - Intergenic
1110012126 13:70349964-70349986 ACTTAGCTATTGCTCCATGCAGG - Intergenic
1110706302 13:78604029-78604051 ACTTAGGCATTCCTCCTCTTCGG + Intergenic
1110762108 13:79242053-79242075 ACTCAGGTCGTCTTCCACCCTGG + Intergenic
1115539333 14:34404305-34404327 ACTAAGGTATCCATCAACCCTGG + Intronic
1115916110 14:38316750-38316772 ATTTAGCTATTCCTCCACTTTGG + Intergenic
1129896641 15:79113304-79113326 ACCAAGGGATTACTCCACCCTGG + Intergenic
1129951590 15:79596785-79596807 GCTGAGGTATCCATCCACCCAGG + Intergenic
1134102893 16:11464961-11464983 ACATAGGTCTTCCCCCACCCAGG + Intronic
1134855038 16:17511430-17511452 AGTCAGCTAATCCTCCACCCTGG + Intergenic
1147437158 17:40423589-40423611 ACTTAGGGATTACTCAACTCTGG - Intergenic
1150914730 17:69425071-69425093 ACTTAGGTATGCTGCCACACTGG - Intronic
1156542130 18:37924622-37924644 ATTTAGTTTTTGCTCCACCCTGG - Intergenic
1159774371 18:72586021-72586043 ACCTGGGTATCCCTCCACTCTGG - Intronic
1163697131 19:18769614-18769636 ACTTGGGCACTCTTCCACCCAGG - Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1168033839 19:53703229-53703251 CCTTAAGTAATCCTCCTCCCTGG + Intergenic
928417105 2:31104619-31104641 ACTGAGGAATTCCTCCAGACTGG - Intronic
932337304 2:70938513-70938535 ACTTAGGCATTCCCCTCCCCCGG + Intronic
933037900 2:77423857-77423879 ACTTTGGGATTCCTGAACCCAGG - Intronic
933670113 2:84999087-84999109 ACTTTGGGATTACTCCAGCCTGG - Intronic
936949734 2:117965987-117966009 ACGTTGTTATTTCTCCACCCTGG - Intronic
937923825 2:127152469-127152491 ACTTACTTATTCCTGCACCCGGG - Intergenic
938101416 2:128500313-128500335 ACTGAGGTCTCACTCCACCCCGG - Intergenic
938390266 2:130899423-130899445 ACTTAGATATTCTTCCTCCAGGG - Intronic
941501147 2:166278465-166278487 AATTAGGTATTGCTCTTCCCTGG + Intronic
942790897 2:179759277-179759299 ACTTAGGTATTGCTTCCCCAGGG - Intronic
1169687386 20:8290457-8290479 ACTTAGGTTTTATTCCAACCAGG + Intronic
1172258396 20:33538980-33539002 ACTTATTTATTCCTCCACATTGG + Intronic
1174797774 20:53536853-53536875 AATTAGGTATTCCTTCTCCCTGG - Intergenic
1175604682 20:60302962-60302984 ACTTATTTCTTCCTGCACCCAGG + Intergenic
1183441000 22:37823135-37823157 ACCTAGGTAGTCCTCCAGGCAGG + Intergenic
1183721449 22:39565093-39565115 CCTCAGGTCTTCCTCCACCAGGG + Intergenic
950250765 3:11463445-11463467 ACTTGGGAATTTCTCCACCCTGG + Intronic
954269685 3:49497890-49497912 ACCTAGGTATAAATCCACCCAGG - Intronic
956595236 3:70959923-70959945 AGATGGGTATTCATCCACCCAGG - Intronic
961496944 3:127300245-127300267 ACTTAGCTATTCCTCCTCTTTGG + Intergenic
962635526 3:137327361-137327383 AGTTTCATATTCCTCCACCCAGG - Intergenic
965485212 3:169270771-169270793 ACTTAAGTATTAGTCCATCCAGG - Intronic
965678718 3:171228538-171228560 ACTTGTGTATTCTTCCACGCAGG - Intronic
979239758 4:118437749-118437771 ACATAGGTGGTTCTCCACCCAGG - Intergenic
982682369 4:158446462-158446484 ACTAAGCTATTCCACCTCCCTGG - Intronic
985796580 5:1966600-1966622 GCTTAGCTTTGCCTCCACCCCGG + Intergenic
987691535 5:21273155-21273177 ACTTAGGCTTTGCTCCACCAGGG + Intergenic
992150231 5:73895309-73895331 ACTTAGTCCTTCCACCACCCTGG - Intronic
993646556 5:90470573-90470595 TCTTAGGTATTCCTCTACATTGG + Intronic
997421199 5:133768133-133768155 ACGAAGGTATTCCTCCTCCTGGG + Intergenic
1000677189 5:164136228-164136250 ACTTAAGCAATCCTCCACCTTGG - Intergenic
1000684776 5:164235183-164235205 AATTAGTTGTTCCTCCACACTGG + Intergenic
1002740007 5:181428331-181428353 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1006193738 6:32224380-32224402 AGTTCTGTATTCCTCCTCCCAGG + Intergenic
1007561891 6:42816123-42816145 ACTTAAGTGATCCTCCACCTTGG - Intronic
1011476425 6:87753330-87753352 ACTGAGGAATTCCTCCAGACTGG - Intergenic
1019245119 6:170703931-170703953 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1022997865 7:35776440-35776462 AGCTAGGAATTCCTCCATCCTGG + Intergenic
1036089272 8:5647689-5647711 ACTTAGAAATTCCTCTGCCCAGG + Intergenic
1041965915 8:63676218-63676240 ATTTATGCATTCCTCCACACAGG - Intergenic
1044121954 8:88408723-88408745 ACTTAAGTAATCCCCCACCTTGG - Intergenic
1047039444 8:120976465-120976487 ACTTAGTTAGGGCTCCACCCTGG - Intergenic
1047166362 8:122443597-122443619 ACTTATCTAATCCTCCACTCTGG + Intergenic
1048749414 8:137654567-137654589 ACTTACTTATGCCTCTACCCTGG + Intergenic
1055133286 9:72800597-72800619 ATTTAGTTAATCCTCCACCTTGG + Intronic
1055441635 9:76342470-76342492 AATCAGGTATTCCCCCACACTGG + Intronic
1056483264 9:87028426-87028448 CCTTAGGTATTTCTCAACCCTGG - Intergenic
1058165040 9:101609672-101609694 CCTTAGGTCCTCCTCCACCTAGG + Intronic
1060107922 9:120885848-120885870 ACTTAGGTATTCCTCCACCCAGG - Intronic
1062301824 9:135877917-135877939 ACTCAGGTTTTCCTCCTTCCCGG - Intronic
1203605314 Un_KI270748v1:53139-53161 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1187906406 X:24070667-24070689 CCTTAGGTAATCCTCCAACTTGG + Intronic
1189589239 X:42494395-42494417 TCTTAGTTATTCCTCCTCCTAGG + Intergenic
1191786340 X:64920689-64920711 ACTTAGGGCTTCCGCCTCCCAGG + Intronic
1193984024 X:88218604-88218626 ACTTAGAAATGCCTCTACCCAGG + Intergenic
1196899462 X:120368633-120368655 ACTTTGGTGTTCATCCAACCAGG - Intronic
1198052931 X:132966087-132966109 ACTTAGATAATCCTCATCCCAGG + Intergenic
1200712437 Y:6499635-6499657 ACATGGGTATTCATCCACCATGG + Intergenic
1201021478 Y:9662322-9662344 ACATGGGTATTCATCCACCATGG - Intergenic
1202387499 Y:24339579-24339601 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1202483287 Y:25330549-25330571 ACATAGGTGGTTCTCCACCCAGG + Intergenic