ID: 1060109190

View in Genome Browser
Species Human (GRCh38)
Location 9:120894514-120894536
Sequence GAGGCGGGTGGGAGGCGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 398}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060109190_1060109202 15 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109202 9:120894552-120894574 GCTCCCGCGAAGGCCGCGGCGGG No data
1060109190_1060109200 11 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109200 9:120894548-120894570 CCGCGCTCCCGCGAAGGCCGCGG No data
1060109190_1060109198 5 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109198 9:120894542-120894564 CTTTGGCCGCGCTCCCGCGAAGG No data
1060109190_1060109207 29 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109207 9:120894566-120894588 CGCGGCGGGAGGCCCCTGATAGG No data
1060109190_1060109201 14 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109201 9:120894551-120894573 CGCTCCCGCGAAGGCCGCGGCGG No data
1060109190_1060109204 18 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109204 9:120894555-120894577 CCCGCGAAGGCCGCGGCGGGAGG No data
1060109190_1060109208 30 Left 1060109190 9:120894514-120894536 CCACGACGCCTCCCACCCGCCTC 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1060109208 9:120894567-120894589 GCGGCGGGAGGCCCCTGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060109190 Original CRISPR GAGGCGGGTGGGAGGCGTCG TGG (reversed) Intronic
900172371 1:1275265-1275287 GATGCGGGTGGGTGGGGTGGTGG - Intergenic
900413721 1:2525659-2525681 GAGGTGGCTGGGAGGTGTCCGGG + Intronic
900658519 1:3772013-3772035 GAGGCGCCGGGGAAGCGTCGGGG - Intergenic
901648456 1:10729065-10729087 GAGGCGGTTGGGAGGCAGCTGGG + Intronic
901775547 1:11558416-11558438 GAGGCGGGTGGGAGAGGACGAGG - Intergenic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
903034717 1:20486241-20486263 GAGGAGGGCGGGAGGAGGCGGGG + Intergenic
903692754 1:25185885-25185907 GAGGTGGGTGGGTGGGGTGGGGG - Intergenic
903777223 1:25800567-25800589 GAGGCGGGTGGGGGGTGCCTGGG + Intronic
903907223 1:26695976-26695998 GAGGCGAGGGGGAGGGGGCGGGG - Intergenic
904003127 1:27349768-27349790 GAGGCGGGAGGGAGGGGACCCGG + Intronic
904563587 1:31414058-31414080 GAGGCGGGTGCGGGTCGTCACGG + Intronic
905515462 1:38558949-38558971 CAGGCGGCTGGGAGGGGGCGGGG - Intergenic
905693718 1:39960367-39960389 GGGGTGGGTGGGGGGCCTCGTGG - Intronic
905847115 1:41242243-41242265 GAGGCGCGGGGGAGGGGCCGGGG - Intergenic
906053412 1:42894106-42894128 GAGAAGGGTGGGAGGGGGCGAGG - Intergenic
908824112 1:68116968-68116990 AAGGTGAGTGGGAGGGGTCGGGG - Intronic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
915074322 1:153296386-153296408 GAGGTGGGTGGGTGGCGGGGGGG - Intergenic
915489817 1:156244794-156244816 CAGGCAGGTGGGAGGCGAAGAGG + Exonic
915921644 1:159980334-159980356 AAGGCTGGTGGAGGGCGTCGGGG - Intergenic
916490987 1:165302198-165302220 GAGGCCGGTGGGGGGCGGGGTGG + Intronic
916773378 1:167935932-167935954 GAGGCGGACGCGAGTCGTCGTGG - Exonic
917141627 1:171841420-171841442 GGGGCGGGGGCGGGGCGTCGCGG + Intergenic
917490496 1:175494142-175494164 GAGGCCGGCGGGAGGGGGCGGGG - Intronic
919693072 1:200544743-200544765 GGGGAGGGAGGGAGGCCTCGTGG + Intergenic
919763550 1:201112631-201112653 GAGGAGGGTGGGGTGGGTCGGGG + Intergenic
920451055 1:206061474-206061496 GAGGGTGGTGGGAGGAGGCGGGG + Intronic
923141063 1:231162095-231162117 GCGGCGGGAGGGAGGCGGGGAGG + Intronic
924415240 1:243850537-243850559 GAGGGGGCGGGGAGGCGGCGGGG - Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924707873 1:246513155-246513177 TGGGAGGGTGGGAGGCCTCGGGG - Intergenic
1063275741 10:4565739-4565761 GGGGCGGGTGGGAGGAGGCGGGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1063665181 10:8056353-8056375 TAGGCGGGTGGGCGGGGTGGAGG + Intronic
1065024380 10:21526594-21526616 GAGGCGCGGCGGGGGCGTCGAGG - Intergenic
1065102650 10:22345863-22345885 GCAGCGGGGCGGAGGCGTCGGGG - Intronic
1067342877 10:45418942-45418964 GAGGTGGGGGCGAGGGGTCGGGG + Intronic
1069943896 10:71973127-71973149 GGGGAGGGTGGCAGGAGTCGTGG + Intronic
1069956393 10:72054453-72054475 GAGGTGGGTGGGAAGGGACGTGG - Intergenic
1071985646 10:91047375-91047397 GGGGCGGGTGGGAAGGGTCAGGG + Intergenic
1073049035 10:100656153-100656175 GAGGAGGGTGAGAGGATTCGCGG + Intergenic
1073392730 10:103192961-103192983 GACGTGGGCCGGAGGCGTCGCGG + Intronic
1074824170 10:117202643-117202665 GAGGCGGCTGGGAGGCCCAGTGG - Intronic
1075013186 10:118892077-118892099 GATGGGGGTGGGGGGGGTCGGGG + Intergenic
1075206398 10:120453156-120453178 GTGGCGGGTGGCAGGTGGCGGGG + Intergenic
1075396761 10:122133243-122133265 GAGGCTGGTGGGAGGTGACATGG - Intronic
1075451867 10:122557342-122557364 GAGCCTGGTGGGAAGGGTCGGGG - Intergenic
1076284184 10:129277295-129277317 GAGGTGCCTGGGAGGCGTCCAGG + Intergenic
1076539473 10:131205003-131205025 GAGCCGGGTGGCAGGGGTTGAGG - Intronic
1076714138 10:132354735-132354757 GAGGTCGGGTGGAGGCGTCGAGG + Intronic
1077094370 11:793072-793094 GAGGATGGTGGGAGCCGTGGAGG + Intronic
1077211245 11:1371874-1371896 GGGCCGGGTGGGAGGAGTCATGG + Intergenic
1077500930 11:2909470-2909492 GACGGGGGTGGGGGGCGACGTGG + Intronic
1080540441 11:33258526-33258548 GCGGCGGGAGGAAGGCGTGGCGG + Intronic
1080767702 11:35311920-35311942 GAGGCGGGGGGGGGGGGTGGGGG + Intronic
1081411226 11:42760632-42760654 GGGGCGGGGGGCAGGCGTGGGGG - Intergenic
1081693150 11:45092050-45092072 GAGGGGGCTGGGAGGAGTCCAGG - Intergenic
1082003806 11:47408848-47408870 GAGGCGGGTGGGACGCGGAGAGG - Intronic
1082071619 11:47944031-47944053 GGGGAGGGTGGGAGGAGTCCCGG + Intergenic
1082862579 11:57869980-57870002 GAGGCTGGTGGGAGGTGTTTGGG - Intergenic
1083728334 11:64640066-64640088 GAAGGGGGTGGGAGGTGTGGGGG - Intronic
1083753704 11:64778098-64778120 GCGGCGGGTACGAGGCGCCGGGG + Exonic
1083894739 11:65614206-65614228 GAGCGGGGTCGGAGCCGTCGGGG - Exonic
1084559105 11:69892797-69892819 GAGCCGGATGGGAGCTGTCGTGG + Intergenic
1085298461 11:75444364-75444386 GAAGCGTGTGGGAGGGGTAGAGG + Intronic
1085681020 11:78574908-78574930 GAGGCGTGCGGGAGGGGGCGGGG + Intergenic
1088522130 11:110711862-110711884 GAGACGGGAGGGAGGCTGCGAGG + Intronic
1089071072 11:115700153-115700175 AAGGAGGGAGGGAGGCGTGGTGG + Intergenic
1089262617 11:117232828-117232850 GGGTCGGGTGGGGGGCGTGGAGG + Intronic
1089923165 11:122229817-122229839 GAGGAGGGGGTGTGGCGTCGGGG - Intergenic
1090195428 11:124812235-124812257 GTGCCGGGTGGGGGGTGTCGGGG + Intergenic
1090372803 11:126268592-126268614 GGGGAGGGTGGGAGGAGGCGCGG + Intronic
1091383682 12:78404-78426 GGGGCGGCTAGGAGGGGTCGGGG + Intronic
1091590550 12:1840445-1840467 GGGGTGGGTGGGGGGCGGCGGGG + Intronic
1092291173 12:7160233-7160255 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291193 12:7160290-7160312 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1094057220 12:26279778-26279800 GAGGCAGGTGGTAGGGGTTGGGG - Intronic
1095440951 12:42238272-42238294 GAGGAGGGAGGGAGGGGGCGGGG + Intronic
1095812286 12:46383621-46383643 GAGGCGGGGAGGAGGCGGGGAGG + Intergenic
1095913355 12:47451218-47451240 GAGAAGGGTGGGAGGGGGCGAGG + Intergenic
1095977070 12:47946999-47947021 GAGGCAGGTGGGAGTGGCCGAGG + Intergenic
1095991299 12:48036432-48036454 GAGGTGGGTGGGAGGCGATGTGG + Intergenic
1096749753 12:53751394-53751416 AAGGGGGGTGGGAGGCGACAGGG - Intergenic
1098487774 12:71041475-71041497 GAGGCTGGTGGGAGGTGTTTGGG - Intergenic
1100885803 12:99068679-99068701 GATGCAGGTGGGAGGGGTGGGGG + Intronic
1103567790 12:121825508-121825530 GAGGCGGGTGGGCGGGGCCTAGG + Intronic
1105058824 12:133129582-133129604 GAGGCGGGCGGGGGGCGGTGAGG + Intronic
1105405125 13:20127363-20127385 GAGGAGGGTGGGGGGTGTGGAGG - Intergenic
1106177409 13:27343002-27343024 GAGGAGGGAGGGAGGGGGCGAGG - Intergenic
1107086374 13:36431738-36431760 GAGGCGGCTGGGACGCGGCGGGG - Intergenic
1107911443 13:45108987-45109009 CAGCCGGGTGGGAGGGGTCCGGG - Intergenic
1110318258 13:74134512-74134534 GGGGCGGGGTGGAGGCGCCGCGG - Intergenic
1113768402 13:112894491-112894513 GAGCCGGGCAGGAAGCGTCGCGG + Intronic
1113993647 14:16049746-16049768 GAGGGGGGTGGGCGGGGTGGGGG - Intergenic
1114215252 14:20653406-20653428 GAGCCGGGTAGGGGGCGTGGGGG + Intergenic
1117755878 14:58973561-58973583 GAGGGGGGTGGGAGGGGGTGTGG + Intergenic
1119633695 14:76256834-76256856 GAGGCTGATGGGAGGCTTTGAGG - Intergenic
1119808695 14:77499003-77499025 GAGGAGGGTGGGGGACGTCCAGG - Intergenic
1121282496 14:92709506-92709528 GAAGCGGGTGGGCGGAGCCGTGG - Intronic
1122220769 14:100238366-100238388 GAGGCGGGTGGGCGGCCCGGGGG - Intronic
1122799679 14:104223361-104223383 GAGGCGGGAGGGCAGGGTCGGGG - Intergenic
1122856107 14:104561013-104561035 GAGGAGGGTGGGAGGTGAGGGGG - Intronic
1125694275 15:41622038-41622060 GGGGAGGGTGGGGGGCGTGGCGG + Intronic
1126297009 15:47150927-47150949 GAGCCTGGTGGGAGGTGTCTGGG - Intergenic
1128355692 15:66925009-66925031 GAGGCGTGTGGGAGGGGTGAAGG + Intergenic
1128752855 15:70161393-70161415 GAGGCAGGTGGGGGGCGGAGAGG + Intergenic
1129423864 15:75451261-75451283 GAGGGGGGTGGGGGGCGGAGCGG - Intronic
1130128791 15:81118477-81118499 GAGCGGGGTGGGAGGCCACGCGG + Intronic
1131154358 15:90065547-90065569 GAGGCTGGTGGGAGGAGCAGGGG + Intronic
1132344759 15:101101459-101101481 GAGGAGGCTGGGAGGCTGCGGGG - Intergenic
1132346134 15:101110159-101110181 GAGCCTGGTGGGAGGTGTTGGGG + Intergenic
1132608753 16:804706-804728 GAGGGTGGTGGGAGGCCTTGAGG + Intergenic
1133038016 16:3045737-3045759 GAAGCGGGCGGGAGGCTTCCTGG - Intergenic
1133463014 16:6003468-6003490 GGGCCGGGTGGGAGGGGTGGTGG - Intergenic
1134614817 16:15643053-15643075 GGGGCGGGGGGAAGGCGGCGGGG - Exonic
1136030037 16:27496020-27496042 GGGCCAGGTGGGAGGCGTCTGGG + Intronic
1136189784 16:28608822-28608844 GTGGCGGGCGGGAGGTGTCCTGG + Exonic
1136317202 16:29461397-29461419 GTGGCGGGCGGGAGGTGTCCTGG - Exonic
1136431777 16:30200740-30200762 GTGGCGGGCGGGAGGTGTCCTGG - Exonic
1136445431 16:30314837-30314859 GAGGCGGGTGGGATCCCTTGAGG - Intergenic
1137584006 16:49653139-49653161 CAGGCGGGTGGGAGGGGACTTGG + Intronic
1137988615 16:53130959-53130981 CAGGCGGGTGCGTGGCGGCGCGG + Intronic
1138389206 16:56657986-56658008 GGGGCAGGTGGAAGGCGTGGTGG - Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138809639 16:60133757-60133779 AAGGAGGGAGGGAGGCGTCAAGG - Intergenic
1141028417 16:80568689-80568711 GAGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141146997 16:81537953-81537975 GAGGCGGGTGGGAAGAGACCCGG + Intronic
1141231392 16:82170561-82170583 CAGGCGGGTGGCAGGCGTGGCGG - Intergenic
1141593515 16:85083786-85083808 GAGGCAGGTGGCAGGGGGCGAGG + Intronic
1141593870 16:85085950-85085972 GAGACTGGTGGGAAGCGTGGGGG + Intronic
1142007503 16:87696502-87696524 GACGTGGGTGGGAGGCGTGGTGG + Intronic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142262535 16:89049655-89049677 GAGGCGGCAGGGAGGCCTCTGGG + Intergenic
1142403665 16:89874026-89874048 GACGCGGGTGGGCGGTGGCGTGG + Intronic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1142810599 17:2393921-2393943 GAGGTGGGAGGGAGGCGCGGGGG + Intronic
1142810602 17:2393932-2393954 GAGGCGCGGGGGAGCCGCCGGGG + Intronic
1143189552 17:5031712-5031734 GGGGTGGGTGCGAGGCGTGGGGG + Intergenic
1143296767 17:5877147-5877169 AAGGCGGGTGGGGGGGGGCGGGG - Intronic
1143515493 17:7417532-7417554 GAAGCGGGGTGGTGGCGTCGGGG + Exonic
1143539753 17:7561978-7562000 GAGGAGGGGGGGAGGAGTGGCGG + Exonic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1145002843 17:19317575-19317597 CTGGCGGGTGGGAGGCGACCGGG + Intronic
1145760971 17:27425357-27425379 TGGGAGGGTGGGAGGCCTCGGGG + Intergenic
1146161015 17:30559515-30559537 TGGGAGGGTGGGAGGCCTCGGGG + Exonic
1146208146 17:30922233-30922255 GGTGTGGGTGGGAGGGGTCGGGG - Intronic
1146878931 17:36432203-36432225 GGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146882871 17:36453349-36453371 GGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1146958098 17:36948938-36948960 GAGGCGCGCGGGAGGGGGCGGGG - Exonic
1147015577 17:37489439-37489461 GAGGCGGTGGGGTGGGGTCGAGG + Intergenic
1147286564 17:39407192-39407214 GAGGGGGGTGGGAGGGGTGTAGG - Exonic
1147833749 17:43315388-43315410 GAAGGGGGTGGGGGGCGGCGGGG + Intergenic
1147987466 17:44314881-44314903 GAGGTGGGTGTGAGGGGTTGGGG - Intronic
1148895356 17:50836195-50836217 GACGGGGGTGGGAGCCGTCGGGG + Intronic
1149454517 17:56777132-56777154 GAGTAGGGTGGGAGGGGTCAGGG - Intergenic
1149660599 17:58332364-58332386 GAGGCGCGTTGGGGGTGTCGAGG - Intergenic
1149866549 17:60154238-60154260 GGGGTGGGTGGGAGGGGTGGGGG + Intronic
1149916420 17:60613894-60613916 GAGGCGGGGGGGTGGCGGGGGGG - Intronic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1151836624 17:76586278-76586300 GTGGCGGGTGGGCGGCGGCCGGG + Intronic
1152259069 17:79256993-79257015 GACGCGGGTGGGAGGAATCTGGG + Intronic
1152468406 17:80477883-80477905 GGGGCGGCGGGGAGGGGTCGGGG - Intergenic
1152501729 17:80715709-80715731 GAGAAGGGTGGGAGGGGGCGAGG - Intronic
1152597015 17:81242653-81242675 GAGGCGGGGGGGAGGGGGAGGGG + Intergenic
1152711228 17:81871265-81871287 GTGGCGGGGCGGAGGCGGCGGGG - Intronic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1154966531 18:21363269-21363291 GGGGCGGGGGGGAGGCGGAGTGG - Intronic
1156149508 18:34224936-34224958 GAGGGGAGTGGGAGGGGTGGGGG - Intronic
1157253225 18:46114792-46114814 GAGGAGGGAGGGAGGAGTCTTGG + Intronic
1157464295 18:47930780-47930802 GAGGTGGGTGCGTGGCGCCGCGG - Intronic
1157610485 18:48952115-48952137 GGGGCGGGGAGGAGGCGGCGCGG - Intergenic
1160241184 18:77124426-77124448 GTGGGGGGTGGGAGGCGTGGTGG - Intronic
1160690974 19:460652-460674 GGGGCGGGCGGGGGGCGGCGGGG - Exonic
1160698389 19:495260-495282 GAGGAGGGTGGGGGGCGAGGGGG + Intronic
1160872207 19:1282557-1282579 GAGGAGGGTGGGAGGGGAGGAGG + Intergenic
1160885957 19:1348166-1348188 AACACGGGTGGGAGGCGTTGAGG - Intergenic
1160980880 19:1816041-1816063 GAGGCGGGTGGGAGGCGGGCAGG + Exonic
1161197070 19:2992800-2992822 GAGGCGGGTGGGGGGGGGGGAGG + Intronic
1161350090 19:3786440-3786462 GGGGCGCGCGGGAGGCGCCGGGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161642487 19:5432905-5432927 GGGGAGGGTGGGAGGTGTCGAGG + Intergenic
1162090536 19:8276834-8276856 GATGCAGGTGGGAGGAGGCGTGG - Intronic
1162092769 19:8291662-8291684 GATGCAGGTGGGAGGAGGCGTGG - Intronic
1162416869 19:10543776-10543798 GAGGCCGCGGGAAGGCGTCGGGG + Intergenic
1162872956 19:13599829-13599851 GAGGCGGCGGGGCGGCGTGGTGG - Intronic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163369853 19:16896066-16896088 GGGGCGGGGCGGAGGAGTCGGGG + Intronic
1163607051 19:18281266-18281288 CAGGGGGGTAGGAGGCGGCGCGG + Exonic
1164458257 19:28426906-28426928 CAGGAGGGTGGGAGGGGTGGAGG + Intergenic
1165071887 19:33260667-33260689 GGGCCGGGTGGGAGGCCTCGTGG - Intergenic
1165420655 19:35720587-35720609 GAAGGGGGTGGGAGGGGTGGAGG - Exonic
1165955367 19:39499048-39499070 GAGCCAGGTGGGAGGTGGCGTGG + Intronic
1166751082 19:45164261-45164283 GAGGCTGGTGGGTGGGGTCGGGG + Intronic
1167128640 19:47569689-47569711 GAGATGGGTGGGGGGCGGCGGGG - Intergenic
1168286937 19:55339951-55339973 GAAGCGGGTGAGGGGCGGCGCGG + Exonic
925420155 2:3704386-3704408 GAGGGGCGTGGGGGGCGTGGGGG + Intronic
925420244 2:3704584-3704606 GAGGGGCGTGGGGGGCGTGGGGG + Intronic
926018560 2:9474911-9474933 GACCCGGGTGGGAGGCGGCGCGG - Intronic
926107680 2:10162676-10162698 CAGGGGGGTGGGGGGCGGCGGGG - Intronic
926225125 2:10961724-10961746 GAGGCGGAGGGGAGGCGGCTGGG - Intergenic
926531730 2:14055494-14055516 GAGGCTGGTGGGAGGTGTTTGGG - Intergenic
927256651 2:21045222-21045244 AAGGCGAGTGGGAGGCGGCCAGG + Intergenic
927714157 2:25341744-25341766 GAGCCGGGCGGGGGGCGCCGCGG - Intronic
928180726 2:29066598-29066620 GAGGTGGGTGGTAGGAGTCGTGG + Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929932009 2:46264661-46264683 GAGGCCTGTGGGAGCCGTGGAGG + Intergenic
932479707 2:72031836-72031858 GAGGTGGGTAGGAGGCGTTCTGG - Intergenic
933666853 2:84971266-84971288 GCGGCGGCGGGGAGGCGGCGCGG - Exonic
933667023 2:84971727-84971749 GAGGGGGAGGGGAGGCGGCGGGG + Intronic
934857416 2:97737911-97737933 GAGGCAGGTGGGCGGTGTGGTGG + Intronic
934949564 2:98567166-98567188 GAGGCTGCTGGGAGGAGTCCAGG + Intronic
934993368 2:98936468-98936490 GAGGCGGGTCGGGAGCGGCGCGG - Intergenic
936938552 2:117860121-117860143 GCGGCAGGTGGAAGGCGCCGCGG - Intergenic
938097126 2:128471326-128471348 GTGGCGGGTGGGAGGAGGCTGGG + Intergenic
938097167 2:128471488-128471510 GTGGCGGGTGGGAGGAGGCTGGG + Intergenic
938097236 2:128471752-128471774 GTGGCGGGTGGGAGGAGGCTGGG + Intergenic
938097304 2:128472014-128472036 GTGGCGGGTGGGAGGAGGCTGGG + Intergenic
938538033 2:132261122-132261144 GAGGGGGGTGGGCGGGGTGGTGG + Intergenic
940353839 2:152717922-152717944 GAGGCGGAGGGGAGGAGGCGGGG + Exonic
941639002 2:167967387-167967409 CAGGCGGGTGGGAGGAGTGTTGG - Intronic
941859168 2:170261254-170261276 GAGGCGGGTGGGATCCCTTGAGG - Intronic
942155307 2:173121738-173121760 GTGGCGGGTGGGCGGCGGGGGGG - Intronic
942213480 2:173694907-173694929 GAGAAGGGTGGGAGGGGTTGAGG + Intergenic
942505613 2:176638268-176638290 GCGGCGGGTGGCGGGCGGCGCGG + Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
946242985 2:218368011-218368033 GACGCGGGCGGGACGCGCCGGGG + Exonic
948244219 2:236464710-236464732 GAGCCTGGTGGGAGGTGTCTGGG + Intronic
948503433 2:238411245-238411267 GGGGCAGGTGGGGGGCGTCAAGG + Intergenic
948527129 2:238578012-238578034 GGGGCCGGTGGGAGGTGTCTGGG - Intergenic
948536645 2:238652003-238652025 GGGGCTGGTGGGAGGTGTCTGGG - Intergenic
948669844 2:239561290-239561312 GAGGTGGGTGGGAGGGGGCTGGG - Intergenic
948864162 2:240767069-240767091 GAGGCCAGTGGGTGGCGTCCTGG - Intronic
948983880 2:241508489-241508511 GCTGCGGGTGGGAGCCTTCGCGG - Exonic
1169065511 20:2692694-2692716 GAGGCGGGGGCGGGGCGGCGCGG - Intergenic
1169164105 20:3407661-3407683 GTGCCGGGTGGGAGGGGGCGCGG + Intergenic
1170096332 20:12649637-12649659 GAGGAGGGGCGGAGGGGTCGGGG + Intergenic
1170613917 20:17934394-17934416 GAAGCGGGCGGGAGGCGGCGAGG - Intergenic
1170645128 20:18190974-18190996 GAGGGGGCTGGGAGGTGTAGGGG + Intergenic
1170732802 20:18988954-18988976 GAGGCGGGAGGGAGGGGGCGAGG + Intergenic
1171413107 20:24959765-24959787 GAGGCGGGTGGGAGGGGACAAGG - Exonic
1171567608 20:26209103-26209125 GAGGCGGGTGGACGGGGTGGGGG - Intergenic
1171866943 20:30492910-30492932 GAGGGGGGTGGGCGGGGTGGGGG + Intergenic
1172277182 20:33686112-33686134 GGGGCCGGTGGGAGCCGGCGGGG + Exonic
1173125896 20:40335697-40335719 GAGGCGGGTGGGAGGTGGAGGGG + Intergenic
1173548505 20:43916298-43916320 GAGGCAGGAGAGAGGCGTCCCGG + Intronic
1173947637 20:46964353-46964375 GTGGAGGCTGGGAGGCGTCTTGG + Intronic
1174804498 20:53593881-53593903 AGGGAGGGAGGGAGGCGTCGCGG + Intronic
1175406945 20:58741163-58741185 GGTGCGGGTGGGTGGCGTGGGGG - Intergenic
1175429807 20:58892557-58892579 GAGTCGGGAGGGGGGCGGCGAGG + Intronic
1175889378 20:62309606-62309628 GAGGAGGGTGGGAGGGGGCAGGG + Intronic
1176144492 20:63559526-63559548 GAGTCAGGTGGGAGGAGTCAGGG + Intronic
1176144518 20:63559627-63559649 GAGTCAGGTGGGAGGAGTCAGGG + Intronic
1176144559 20:63559786-63559808 GAGTCAGGTGGGAGGAGTCAGGG + Intronic
1176281472 20:64316314-64316336 GGGGCGGCTAGGAGGGGTCGGGG - Intergenic
1176408995 21:6437583-6437605 GAGGCAGGTGGGAGGAGGAGAGG - Intergenic
1176549749 21:8216078-8216100 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1176557640 21:8260307-8260329 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1176568674 21:8399112-8399134 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1176576588 21:8443347-8443369 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1176733485 21:10521897-10521919 AGGGAGGGAGGGAGGCGTCGCGG - Intronic
1178824544 21:36004796-36004818 GAGGCGGGGGGCAGGCGGGGGGG + Intergenic
1178824565 21:36004833-36004855 GAGGCGGGGGGGAGGAGGCGGGG + Intergenic
1179419726 21:41225820-41225842 GAGGAGGCTGGGAGGCATCCTGG + Intronic
1179491029 21:41741731-41741753 GAGGAGGGTGCGGGGTGTCGTGG - Exonic
1179529741 21:42010443-42010465 GGGGCGGGGGGGGGGCCTCGCGG + Intergenic
1179684488 21:43045905-43045927 GAGGCAGGTGGGAGGAGGAGAGG - Intergenic
1179917089 21:44484805-44484827 GAGGGGCGTGCGGGGCGTCGGGG + Intergenic
1180064684 21:45406197-45406219 GAGGCCCGGGGGAGGCGGCGGGG + Intronic
1180101690 21:45590615-45590637 GAGGCGGGGCGGAGGCATGGGGG + Intergenic
1180154946 21:45973204-45973226 GAGGCGGCTGCGAGGCTGCGGGG - Intergenic
1180313619 22:11257767-11257789 GAGGGGGGTGGGCGGGGTGGGGG + Intergenic
1180560398 22:16610276-16610298 AGGGAGGGAGGGAGGCGTCGCGG + Intergenic
1181519405 22:23436597-23436619 GAGCCGGGGGGGAGGGGTGGGGG + Intergenic
1181997917 22:26897641-26897663 GAGGCTGGTGGGAGGTGAGGGGG + Intergenic
1182024676 22:27108861-27108883 GGGGCGGGGGGGGGGTGTCGGGG - Intergenic
1182278637 22:29205878-29205900 GAGGCGGGCGGGCGGGGGCGGGG - Exonic
1182904130 22:33921326-33921348 GAGGCGGCCGGGAGCCGCCGGGG - Intronic
1182972100 22:34588871-34588893 GAGGCGGCAGGGAGGCGGAGGGG - Intergenic
1183107188 22:35622883-35622905 GAGCGGGGTGGGAGGAGTCCTGG - Intronic
1183360389 22:37380172-37380194 GCGGCGTGTGGGAGGGGTTGAGG + Intronic
1184225409 22:43126871-43126893 GATGCGGGTGGGAGGGGTACAGG - Intronic
1184252875 22:43270924-43270946 GAGGCAGGTGGCAGGGGTCAGGG - Intronic
1184296967 22:43531026-43531048 GAGGCGGGGGCGAGGCGAGGAGG - Intronic
1185211027 22:49570580-49570602 GAGGCTGGTGGGGGGGGTGGTGG - Intronic
1203254638 22_KI270733v1_random:132404-132426 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1203262694 22_KI270733v1_random:177483-177505 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
949706090 3:6818418-6818440 GAGCCTGGTGGGAGGTGTTGGGG - Intronic
950099890 3:10350219-10350241 GGGGCGGGTCGGTGGGGTCGGGG + Intronic
950153845 3:10708052-10708074 GAGGCGGGCGGGCGGCGGCGGGG - Intergenic
950717956 3:14863021-14863043 GAGGCGGGTGGGGGACATCAGGG - Intronic
950896442 3:16455952-16455974 GCGGTGGGAGGGAGGTGTCGGGG - Intronic
951485181 3:23202914-23202936 GAGGGGGTGGGGAGGCGGCGAGG - Intergenic
952898114 3:38092718-38092740 GAGGAGGGTGGGAGGCGGGGAGG + Intronic
953492792 3:43364588-43364610 GAGGCTCGTGGGGGGCGTGGTGG + Intronic
953982006 3:47417865-47417887 GAGGGGGGTGAGAGGGGGCGGGG + Intronic
954277921 3:49554574-49554596 CAGGCGGGCGGGCGGGGTCGGGG - Exonic
954316313 3:49803550-49803572 GAGGCGGGGTGGGGGCGGCGTGG + Intronic
960668777 3:120136605-120136627 GAGGCTGGGGGGGGGAGTCGGGG + Intergenic
960925732 3:122793787-122793809 GAGCCGGGCGGGAGTCGCCGGGG - Exonic
961378948 3:126484771-126484793 GAGGCTGGTGGGAGGTGTGAGGG - Intronic
961602979 3:128075396-128075418 GAGGCAGGGGGCAGGTGTCGAGG + Intronic
963454070 3:145521745-145521767 AAGGGGGGTGGGAGGCATCCAGG + Intergenic
965166216 3:165196437-165196459 GAGGGGGGTGGGAGGGGGAGGGG + Intronic
967329517 3:188276551-188276573 GAGTCTGGTGGGAGGTGTTGGGG + Intronic
967859297 3:194139679-194139701 GAGGCTGGCGGGAGGGGCCGGGG - Intergenic
967913449 3:194560422-194560444 CAGGTGGGTGGGAGGCTTTGTGG - Intergenic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613877 4:1568753-1568775 GAGTGGGGTGGGAGGTGGCGCGG - Intergenic
968613887 4:1568779-1568801 GGCGCGGGTGGGAGGCGGCGCGG - Intergenic
968613893 4:1568795-1568817 GCTGCGGGTCGGAGGCGGCGCGG - Intergenic
968674724 4:1871363-1871385 GCGGCGGGCGGGAGGCGCGGGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
970062358 4:12049569-12049591 GAGGCTGGTGGGAGGTGTTTGGG + Intergenic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
970967861 4:21948809-21948831 GAGGCCGGCGGGGGGCGCCGGGG + Intergenic
971457890 4:26861144-26861166 GAGGCGGGATGAAGGCGCCGAGG - Exonic
972396613 4:38663974-38663996 GGGGCGGGGCGGAGGCGGCGCGG + Intergenic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
976130984 4:81883650-81883672 GAGGCAGGTGGGAGAAGTCAGGG + Intronic
976623789 4:87156397-87156419 GAGGCAGGTGGGGGTCGTGGGGG + Intergenic
977209639 4:94204802-94204824 GAGGCGGGTTGGGGGCATCAAGG - Intergenic
977869759 4:102077482-102077504 GTGGAGGGTGGGAGGAGTGGTGG + Intergenic
978369785 4:108018605-108018627 GGGGCGGGTGGGAGGAGAGGAGG - Intronic
983632155 4:169860154-169860176 GAGGCCGGTGGGAGGGGTGTGGG + Intergenic
984952488 4:185017858-185017880 GGGGCGGGTGGGAGGATTGGGGG - Intergenic
985512480 5:320623-320645 GGGGCGGGTTGGGGGCGTCAGGG + Intronic
986127236 5:4894413-4894435 GAAGCGGGTGGGAGTCATGGGGG + Intergenic
989638032 5:43556902-43556924 GACGCGGGGGGAAGGCGCCGCGG + Exonic
991182576 5:63770664-63770686 GAGGCGAGTGGGGGGTGTCTGGG - Intergenic
992527938 5:77630066-77630088 CAGGCGGAGGGGAGGCCTCGCGG + Exonic
996288454 5:121823604-121823626 GGGAAGGGTGGGAGGGGTCGAGG - Intergenic
996857352 5:128023839-128023861 GAGGTGGGTGGGATGGGTCTTGG - Intergenic
997032309 5:130145126-130145148 GAGGCTGGTGGGAGGTGACTGGG - Intronic
999219101 5:149960398-149960420 AAGGCGGGTGGGAGGGAACGGGG + Intergenic
999279448 5:150355460-150355482 GGGGCGGGTGGTAGGTGGCGGGG - Intergenic
1001307383 5:170585444-170585466 GAGGCTGGGGAGAGGCTTCGGGG - Intronic
1001350152 5:170954545-170954567 GAGGTGGGTGGGTGGGGTTGGGG - Intronic
1001382453 5:171313498-171313520 GAGGCGGGTGGGGGTGCTCGTGG - Intergenic
1002784834 6:392854-392876 CAGGCGGGTAGGAGCCTTCGCGG + Intronic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002913721 6:1511288-1511310 GAGTCGGGTGGGAGTCCTCCTGG - Intergenic
1003150980 6:3548746-3548768 GAGGAGGTTGGGAGGAGGCGTGG + Intergenic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006599695 6:35217233-35217255 GGGGCGGGGGGGAGGCGCGGCGG + Intronic
1007239742 6:40416426-40416448 GTGGTGGGTGGGAGGAGTGGTGG + Intronic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007810698 6:44483496-44483518 GAGGGCGGTGGGAGGCGGTGGGG - Intergenic
1013619299 6:111872940-111872962 CAGGCGGCGGGGATGCGTCGCGG - Intronic
1017902154 6:158727628-158727650 GAGGTGGGCGGGTGGCCTCGAGG - Intronic
1018867224 6:167755662-167755684 GAAGCGGGTGGGACTCGTCCTGG + Intergenic
1020139965 7:5606700-5606722 GAGGTGGGTGGGAGGGCTGGCGG + Intergenic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1020278331 7:6637569-6637591 GAGGCCGCGGGGAGGCGGCGGGG + Intronic
1021740316 7:23680120-23680142 GAGGCGGGCGGGAGGGGGCGCGG + Exonic
1021814360 7:24432972-24432994 GAGGCGGGCGGGAGGGGGCACGG + Intergenic
1022629370 7:32070883-32070905 GAGCCGGGTGCGCGGCGTCCGGG - Intronic
1022704531 7:32790036-32790058 GAGGAGGGTGGGTGGCGATGGGG - Intergenic
1022795352 7:33727441-33727463 GAGGGGGGTGGGGGGCTGCGAGG + Intronic
1023875825 7:44285807-44285829 GCGGCGGGGGGGAGGCGCGGCGG + Intronic
1026894133 7:74000285-74000307 GCGGCGGGTGGGGGGGGGCGGGG + Intergenic
1027138217 7:75639248-75639270 GAGGGGGAGGGGAGGCGGCGAGG + Intronic
1027236975 7:76303886-76303908 GGGGTGGGTGGGTGGCGTGGGGG + Intronic
1029222572 7:99002118-99002140 GAGGCGGGGGGGTGGGGTGGTGG + Intronic
1032508703 7:132455064-132455086 GAGGAGGTTGGGAGACGTCTGGG + Intronic
1033769054 7:144527950-144527972 GAGGCGGGTGGGAGGCGGGTGGG + Intronic
1034393165 7:150801213-150801235 GAGGAGGGGGTGAGGGGTCGAGG + Exonic
1034469775 7:151248964-151248986 GAGGCCCGCGGGAGGCGGCGCGG + Exonic
1034974818 7:155441926-155441948 GAGGGGGGAGGGAGGTGTCCTGG - Intergenic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1035050538 7:155996334-155996356 GAGCCTGGTGGGAGGTGTCTGGG + Intergenic
1035283100 7:157789464-157789486 GAGGCTCGTGGGAGGCCTCCAGG + Intronic
1035314470 7:157989614-157989636 GAGGGGGGTGGGTGCCTTCGTGG + Intronic
1037712386 8:21365295-21365317 GAGGTGGATGGGAGGGGTTGAGG - Intergenic
1038477416 8:27877922-27877944 AAGGCGGCTGGGAGGAGTGGAGG + Intronic
1038670312 8:29577802-29577824 GATGGGGGTGGGAGGCGATGGGG - Intergenic
1041673649 8:60516956-60516978 GAGGCGGGGCGGAGGCGCCGCGG + Exonic
1042558561 8:70054804-70054826 GAGGGGGTGGGGAGGCGTGGTGG - Intronic
1045098988 8:98825987-98826009 GCGGCGGGTGGGCGGGGCCGGGG + Intronic
1045305279 8:100952251-100952273 GAGCGGGGTGGGAGGAGTGGCGG - Intronic
1045412022 8:101929380-101929402 GAGGAGGGAGGGAGGCATGGAGG + Intronic
1045556775 8:103222028-103222050 GTGGCGGGTGGGGGGCTTCCAGG + Intronic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1046568390 8:115930695-115930717 GGGGGGGGTGGGGGGCGTGGCGG + Intergenic
1047254911 8:123207454-123207476 GAGGCGGGTGTGGGGCCGCGGGG - Exonic
1047369985 8:124248074-124248096 GAAGCGGGGGGGAGGCATAGGGG + Intergenic
1047747206 8:127854066-127854088 GAGGAGGGTGGGCGGCCTTGGGG - Intergenic
1048355924 8:133654046-133654068 GATTCTGGTGGGAGGCGTTGGGG + Intergenic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049687280 8:143944047-143944069 GAGGCGGGCGGGAGCTGTTGTGG - Intronic
1049746966 8:144267098-144267120 GTCGCGGGCGGGAGGCGGCGGGG - Exonic
1051774793 9:20621982-20622004 GAGGAGGGAGGGAGGCGCGGGGG + Intronic
1052710014 9:32042590-32042612 GAGGTGGGTGGGAAGAGTCAAGG - Intergenic
1053240061 9:36487787-36487809 GGGGCGGGAGGGCGGCGCCGAGG + Intergenic
1053323499 9:37120728-37120750 GGGGCGGACGGGAGACGTCGAGG - Exonic
1054112565 9:61123641-61123663 GAGGCGGGAGGCAGGGGGCGGGG + Intergenic
1054595144 9:67058490-67058512 GAGGCGGGAGGCAGGGGGCGGGG - Intergenic
1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG + Intronic
1060007790 9:120015666-120015688 GAGGCAGGTGGGAGATGTCTTGG - Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060555320 9:124504856-124504878 GAGGCGGGAGGGGGGAGCCGAGG - Intronic
1060920557 9:127417702-127417724 TAGGCGGGTGGGAGGCCCTGGGG + Intergenic
1061222456 9:129260122-129260144 GCGGAGGGTGGGAGGGGTCATGG - Intergenic
1061244576 9:129394824-129394846 GAGGCGGCTGAGAGCCGTGGGGG + Intergenic
1061860184 9:133464026-133464048 GAGGCGGGTCGGAGTTGTCACGG + Intronic
1061874105 9:133535372-133535394 GAGGTGGGGGGCAGGCGGCGGGG + Intronic
1062121508 9:134836398-134836420 GGGCCTGGTGGGAGGCGTCTGGG - Intronic
1203792572 EBV:159700-159722 GAGGCGAGGAGGAGGCGTCCCGG - Intergenic
1203731921 Un_GL000216v2:98925-98947 GAGGCGGGTCGGCGAAGTCGGGG + Intergenic
1203471039 Un_GL000220v1:115549-115571 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1203478860 Un_GL000220v1:159521-159543 GAGGAGGGGAGGAGGCGTGGGGG - Intergenic
1186555726 X:10556322-10556344 GATGCGGGTGGCAGGGGTGGAGG - Intronic
1187067594 X:15855285-15855307 GAGGAGGGTGGGAGGAGACGAGG + Intergenic
1188811276 X:34656765-34656787 GGGGCGGGAGGCAGGGGTCGCGG + Intronic
1189002113 X:36958156-36958178 GGGGCGGGAGGCAGGGGTCGCGG - Intergenic
1189328041 X:40125007-40125029 GAGGGGTGTGTGTGGCGTCGGGG + Intronic
1190109724 X:47582258-47582280 GAGGCGGGTGGGAGAGGAGGAGG + Intronic
1190713323 X:53084685-53084707 GAGGTGGGTGGGAAGGGCCGTGG + Intronic
1190789730 X:53687048-53687070 GCGGAGGGTGGGAGACGACGTGG + Intergenic
1194746556 X:97634852-97634874 GTAGCGGGTGGGAGACGTAGAGG + Intergenic
1195877899 X:109561471-109561493 GGGCCTGGTGGGAGGTGTCGGGG + Intergenic
1198254738 X:134915010-134915032 GATGCGGGTGGGCGGCGGGGAGG - Intronic
1200049920 X:153423245-153423267 CAGGTGGGTGGTAGGCGTGGTGG + Intergenic
1200209803 X:154342212-154342234 GAGGCGGGGGCGGGGCGTGGAGG - Intergenic
1200221049 X:154389880-154389902 GAGGCGGGGGCGGGGCGTGGAGG + Intergenic